Página 1 dos resultados de 459 itens digitais encontrados em 0.012 segundos

Genes Induced by Reovirus Infection Have a Distinct Modular Cis-Regulatory Architecture

Lapadat, R.; DeBiasi, R.L.; Johnson, G.L.; Tyler, K.L.; Shah, I.
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em //2005 EN
Relevância na Pesquisa
438.59316%
The availability of complete genomes and global gene expression profiling has greatly facilitated analysis of complex genetic regulatory systems. We describe the use of a bioinformatics strategy for analyzing the cis-regulatory design of genes diferentially regulated during viral infection of a target cell. The large-scale transcriptional activity of human embryonic kidney (HEK293) cells to reovirus (serotype 3 Abney) infection was measured using the Affymetrix HU-95Av2 gene array. Comparing the 2000 base pairs of 5’ upstream sequence for the most differentially expressed genes revealed highly preserved sequence regions, which we call “modules”. Higher-order patterns of modules, called “super-modules”, were significantly over-represented in the 5’ upstream regions of transcriptionally responsive genes. These supermodules contain binding sites for multiple transcription factors and tend to define the role of genes in processes associated with reovirus infection. The supermodular design encodes a cis-regulatory logic for transducing upstream signaling for the control of expression of genes involved in similar biological processes. In the case of reovirus infection, these processes recapitulate the integrated response of cells including signal transduction...

Molecular Cloning and Identification of the Transcriptional Regulatory Domain of the Goat Neurokinin B Gene TAC3

SUETOMI, Yuta; MATSUDA, Fuko; UENOYAMA, Yoshihisa; MAEDA, Kei-ichiro; TSUKAMURA, Hiroko; OHKURA, Satoshi
Fonte: The Society for Reproduction and Development Publicador: The Society for Reproduction and Development
Tipo: Artigo de Revista Científica
EN
Relevância na Pesquisa
438.84848%
Neurokinin B (NKB), encoded by TAC3, is thought to be an important accelerator of pulsatile gonadotropin-releasing hormone release. This study aimed to clarify the transcriptional regulatory mechanism of goat TAC3. First, we determined the full-length mRNA sequence of goat TAC3 from the hypothalamus to be 820 b, including a 381 b coding region, with the putative transcription start site located 143-b upstream of the start codon. The deduced amino acid sequence of NKB, which is produced from preproNKB, was completely conserved among goat, cattle, and human. Next, we cloned 5’-upstream region of goat TAC3 up to 3400 b from the translation initiation site, and this region was highly homologous with cattle TAC3 (89%). We used this goat TAC3 5’-upstream region to perform luciferase assays. We created a luciferase reporter vector containing DNA constructs from –2706, –1837, –834, –335, or –197 to +166 bp (the putative transcription start site was designated as +1) of goat TAC3 and these were transiently transfected into mouse hypothalamus-derived N7 cells and human neuroblastoma-derived SK-N-AS cells. The luciferase activity gradually increased with the deletion of the 5’-upstream region, suggesting that the transcriptional suppressive region is located between –2706 and –336 bp and that the core promoter exists downstream of –197 bp. Estradiol treatment did not lead to significant suppression of luciferase activity of any constructs...

Partial androgen insensitivity syndrome and t(X;5): Are there upstream regulatory elements of the androgen receptor gene?

Lower, K.; Kumar, R.; Woollatt, E.; Villard, L.; Gecz, J.; Sutherland, G.; Callen, D.
Fonte: Karger Publicador: Karger
Tipo: Artigo de Revista Científica
Publicado em //2004 EN
Relevância na Pesquisa
615.0615%
BACKGROUND/AIMS: Two half-brothers with similar malformed genitals, who both inherited a maternally derived t(X;5)(q13;p15) translocation, have a phenotype consistent with partial androgen sensitivity syndrome. The aim was to identify the gene disrupted by the X chromosome breakpoint. METHODS: The breakpoint was localized using fluorescence in situ hybridization to metaphase spreads of the translocation. RESULTS: The breakpoint on the X chromosome of the X;5 translocation was localized to a 30-kb region. This region does not contain any identified genes or transcripts. However, the breakpoint is approximately 134 kb from the 5' end of the androgen receptor (AR) gene. CONCLUSIONS: Genetic defects of the AR gene are collectively called androgen insensitivity syndrome and include a range of phenotypes from normal males, often with associated sterility, to XY females. The phenotype seen in the males with the t(X;5) is consistent with this syndrome. The analysis of the chromosomal abnormality suggests that this translocation may remove one or more upstream regulatory elements of the AR gene that are essential for its normal expression and its role in typical external masculinization.; K.M. Lower, R. Kumar, E. Woollatt, L. Villard, J. Gecz...

Use of site-directed mutagenesis to identify an upstream regulatory sequence of sodA gene of Escherichia coli K-12.

Naik, S M; Hassan, H M
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em /04/1990 EN
Relevância na Pesquisa
524.0216%
Mn-containing superoxide dismutase (SodA; superoxide:superoxide oxidoreductase, EC 1.15.1.1) biosynthesis in Escherichia coli is regulated by several environmental stimuli. The DNA sequence of sodA shows the presence of a potential binding site for a regulatory protein(s) at the -35 region. To explore the possible role of this region in the regulation of sodA, we used oligonucleotide-directed site-specific mutagenesis to change the sequence of nucleotides -48 through -44 from 5'-GGCAT-3' to 5'-TTACG-3'. We studied the effect of this altered sequence on the expression of sodA. The data showed that the altered sequence resulted in the constitutive expression of the gene. Thus, E. coli harboring a plasmid containing the mutated sodA gene (pSNM6) were uninducible by paraquat in aerobiosis or by 2,2'-dipyridyl in aerobiosis or anaerobiosis. Furthermore, a multicopy plasmid containing the mutated sodA failed to titrate the repressor molecules present in an E. coli strain carrying the sodA-lacZ fusion. In contrast, multicopy plasmids containing the wild-type sodA gene were able to titrate the repressor protein and to cause the anaerobic induction of beta-galactosidase in this sodA-lacZ fusion strain. These results indicate that the region within and around the mutated sequence probably plays an important role in sodA regulation and that the mutation disrupts a sequence that interacts with the repressor.

Comparison of two yeast invertase genes: conservation of the upstream regulatory region.

Sarokin, L; Carlson, M
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em 11/09/1985 EN
Relevância na Pesquisa
518.43312%
The yeast genome contains a dispersed family of invertase structural genes (SUC1-SUC5, SUC7). Five of these genes are located very close to telomeres and are flanked by large regions of homologous sequence; recombination between telomeres could account for the dispersal of these SUC genes to different chromosomes. The SUC2 locus, in contrast, is not near a telomere and does not share large regions of flanking homology with the other loci. We examine here the relationship between SUC2 and one of the telomeric genes, SUC7. Sequence comparison revealed homology extending from about position -624 to +1791, which is close to the end of the mRNA. The 5' noncoding sequence includes two highly conserved regions: the region between -140 and +1, which contains the TATA box and presumably other promoter elements, and a second region extending from -508 to -400, which corresponds to the upstream regulatory region.

The regulatory VirG protein specifically binds to a cis-acting regulatory sequence involved in transcriptional activation of Agrobacterium tumefaciens virulence genes.

Jin, S G; Roitsch, T; Christie, P J; Nester, E W
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em /02/1990 EN
Relevância na Pesquisa
642.08008%
Virulence genes of Agrobacterium tumefaciens are induced in parallel in the presence of plant phenolic compounds such as acetosyringone and the two regulatory vir genes virA and virG. In this study we identified a cis-acting regulatory sequence in the 5'-noncoding region of the virE operon that is essential for this activation. To do this, we constructed a series of deletion mutants by using exonuclease Bal 31. Western blot (immunoblot) analysis showed that the 70 base pairs upstream of the transcriptional start site were sufficient for full virE gene induction. A conserved dodecadeoxynucleotide sequence (vir box), which was previously identified in the nontranscribed sequences of all vir genes, was located at 5' end of the minimum required promoter sequence. Deletion of this vir box only completely abolished induction of the virE gene. This demonstrates that the vir box functions as an upstream regulatory sequence. To study the role of the VirG protein in the activation process, we overproduced the native-sized VirG protein in Escherichia coli by fusing the lacZ' start codon ATG with the second virG codon AAA using site-directed mutagenesis. The VirG protein was purified and renatured from E. coli and was shown to bind to a specific sequence in two vir gene promoters. Footprinting analysis of the virE and virB promoters identified the 12-base-pair vir box as the VirG-binding core sequence.

Identification of upstream regulatory elements involved in the developmental expression of the Arabidopsis thaliana cab1 gene.

Ha, S B; An, G
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em /11/1988 EN
Relevância na Pesquisa
535.30383%
We studied cis regulatory elements controlling the light-dependent organ-specific expression of Arabidopsis thaliana chlorophyll a/b binding protein gene (cab1) by stably transforming tobacco plants using a tumor-inducing (Ti) plasmid vector system. The results from the 5' and internal deletion analyses indicate that there are at least three cis-acting elements that are involved in the light-dependent developmental expression of cab1 gene. Two such elements are located at the immediate upstream regulatory region and the other element is located at the further upstream region. The 1120-base-pair (bp) DNA fragment containing the immediate and far upstream region can confer light-inducible organ specificity on the truncated nos promoter. However, deletion of the 39-bp DNA fragment at the immediate upstream regulatory region from this hybrid promoter resulted in a nonfunctional promoter, revealing that the 39-bp region is important for the cab promoter specificity. Further analyses of this region suggest that a potential Z-DNA-forming sequence (ATACGTGT) is involved in light-dependent developmental expression of the cab1 gene. Two additional Z-DNA-forming sequences (ACACATAT) that are inverted repeats of this sequence are also found in the upstream region where the additional regulatory elements are expected.

Activation of the major immediate early gene of human cytomegalovirus by cis-acting elements in the promoter-regulatory sequence and by virus-specific trans-acting components.

Stinski, M F; Roehr, T J
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em /08/1985 EN
Relevância na Pesquisa
444.08547%
Upstream of the major immediate early gene of human cytomegalovirus (Towne) is a strong promoter-regulatory region that promotes the synthesis of 1.95-kilobase mRNA (D. R. Thomsen, R. M. Stenberg, W. F. Goins, and M. F. Stinski, Proc. Natl. Acad. Sci. U.S.A. 81:659-663, 1984; M. F. Stinski, D. R. Thomsen, R. M. Stenberg, and L. C. Goldstein, J. Virol. 46:1-14, 1983). The wild-type promoter-regulatory region as well as deletions within this region were ligated upstream of the thymidine kinase, chloramphenicol acetyltransferase, or ovalbumin genes. These gene chimeras were constructed to investigate the role of the regulatory sequences in enhancing downstream expression. The regulatory region extends to approximately 465 nucleotides upstream of the cap site for the initiation of transcription. The extent and type of regulatory sequences upstream of the promoter influences the level of in vitro transcription as well as the amount of in vivo expression of the downstream gene. The regulatory elements for cis-activation appear to be repeated several times within the regulatory region. A direct correlation was established between the distribution of the 19 (5' CCCCAGTTGACGTCAATGGG 3')- and 18 (5' CACTAACGGGACTTTCCAA 3')-nucleotide repeats and the level of downstream expression. In contrast...

Identification of an upstream activating sequence and an upstream repressible sequence of the pyruvate kinase gene of the yeast Saccharomyces cerevisiae.

Nishizawa, M; Araki, R; Teranishi, Y
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em /02/1989 EN
Relevância na Pesquisa
538.72945%
To clarify carbon source-dependent control of the glycolytic pathway in the yeast Saccharomyces cerevisiae, we have initiated a study of transcriptional regulation of the pyruvate kinase gene (PYK). By deletion analysis of the 5'-noncoding region of the PYK gene, we have identified an upstream activating sequence (UASPYK1) located between 634 and 653 nucleotides upstream of the initiating ATG codon. The promoter activity of the PYK 5'-noncoding region was abolished when the sequence containing the UASPYK1 was deleted from the region. Synthetic UASPYK1 (26mer), in either orientation, was able to restore the transcriptional activity of UAS-depleted mutants when placed upstream of the TATA sequence located at -199 (ATG as +1). While the UASPYK1 was required for basal to intermediate levels of transcriptional activation, a sequence between -714 and -811 was found to be necessary for full activation. On the other hand, a sequence between -344 and -468 was found to be responsible for transcriptional repression of the PYK gene when yeast cells were grown on nonfermentable carbon sources. This upstream repressible sequence also repressed transcription, although to a lesser extent, when glucose was present in the medium. The possible mechanism for carbon source-dependent regulation of PYK expression through these cis-acting regulatory elements is discussed.

Gel mobility shift scanning of pectin-inducible promoter from Penicillium griseoroseum reveals the involvement of a CCAAT element in the expression of a polygalacturonase gene

Ribon, Andréa de O. B.; Ribeiro, João Batista; Gonçalves, Daniel B.; de Queiroz, Marisa V.; de Araújo, Elza F.
Fonte: Sociedade Brasileira de Genética Publicador: Sociedade Brasileira de Genética
Tipo: Artigo de Revista Científica
EN
Relevância na Pesquisa
519.11156%
Previous reports have described pgg2, a polygalacturonase-encoding gene of Penicillium griseoroseum, as an attractive model for transcriptional regulation studies, due to its high expression throughout several in vitro growth conditions, even in the presence of non-inducing sugars such as sucrose. A search for regulatory motifs in the 5' upstream regulatory sequence of pgg2 identified a putative CCAAT box that could justify this expression profile. This element, located 270 bp upstream of the translational start codon, was tested as binding target for regulatory proteins. Analysis of a 170 bp promoter fragment by electrophoretic mobility shift assay (EMSA) with nuclear extracts prepared from mycelia grown in pectin-containing culture medium revealed a high mobility complex that was subsequently confirmed by analyzing it with a double-stranded oligonucleotide spanning the CCAAT motif. A substitution in the core sequence for GTAGG partially abolished the formation of specific complexes, showing the involvement of the CCAAT box in the regulation of the polygalacturonase gene studied.

Ubiquitous upstream repression sequences control activation of the inducible arginase gene in yeast.

Sumrada, R A; Cooper, T G
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em /06/1987 EN
Relevância na Pesquisa
438.9767%
Expression of the yeast arginase gene (CAR1) responds to both induction and nitrogen catabolite repression. Regulation is mediated through sequences that both positively and negatively modulate CAR1 transcription. A short sequence, 5'-TAGCCGCCGAGGG-3', possessing characteristics of a repressor binding site, plays a central role in the induction process. A fragment containing this upstream repression sequence (URS1) repressed gene expression when placed either 5' or 3' to the upstream activation sequences of the heterologous gene CYC1. Action of the URS and its cognate repressor was overcome by CAR1 induction when the URS was situated cis to the CAR1 flanking sequences. This was not observed, however, when it was situated downstream of a heterologous CYC1 upstream activation sequence indicating that URS function is specifically neutralized by cis-acting elements associated with CAR1 induction. Searches of sequences in various gene banks revealed that URS1-like sequences occur ubiquitously in genetic regulatory regions including those of bacteriophage lambda, yeast, mammalian, and viral genes. In a significant number of cases the sequence is contained in a region associated with negative control of yeast gene regulation. These data suggest the URS identified in this work is a generic repressor target site that apparently has been conserved during the evolution of transcriptional regulatory systems.

Novel transcriptional control of the pyruvate formate-lyase gene: upstream regulatory sequences and multiple promoters regulate anaerobic expression.

Sawers, G; Böck, A
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em /05/1989 EN
Relevância na Pesquisa
537.78406%
The sequence of the 5' regulatory region of the gene encoding pyruvate formate-lyase is presented together with a detailed analysis of the transcriptional signals required for its expression. The sequence data revealed that a gene coding for an open reading frame (orf) of unknown function is situated just upstream of the pfl gene. Analysis of RNA transcripts by Northern blot hybridization demonstrated that the genes for orf and pfl were cotranscribed as an operon but that the pfl gene was also transcribed alone. S1 nuclease protection analysis, primer extension, and construction of lacZ fusions with sequential deletions in the pfl 5' regulatory sequence revealed that transcription initiated from at least six promoters which spanned 1.2 kilobases of DNA. Three of these lay within the orf structural gene and were responsible for the high expression of pfl. All transcripts originating from these promoters terminated in the 3' untranslated region of the pfl gene at a strong rho-independent transcription terminator. All of the promoters were coordinately regulated by anaerobiosis, pyruvate, nitrate, and the fnr gene product, and the sequences thought to be responsible for this regulation lay 0.8 to 1.3 kilobases upstream of the translational initiation codon of the pfl gene. There were two sequences within this region which showed strong homology with that proposed to be required for recognition by the Fnr protein.

Tripartite structure of the Saccharomyces cerevisiae arginase (CAR1) gene inducer-responsive upstream activation sequence.

Viljoen, M; Kovari, L Z; Kovari, I A; Park, H D; van Vuuren, H J; Cooper, T G
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em /11/1992 EN
Relevância na Pesquisa
530.7989%
Arginase (CAR1) gene expression in Saccharomyces cerevisiae is induced by arginine. The 5' regulatory region of CAR1 contains four separable regulatory elements--two inducer-independent upstream activation sequences (UASs) (UASC1 and UASC2), an inducer-dependent UAS (UASI), and an upstream repression sequence (URS1) which negatively regulates CAR1 and many other yeast genes. Here we demonstrate that three homologous DNA sequences originally reported to be present in the inducer-responsive UASI are in fact three exchangeable elements (UASI-A, UASI-B, and UASI-C). Although two of these elements, either the same or different ones, are required for transcriptional activation to occur, all three are required for maximal levels of induction. The elements operate in all orientations relative to one another and to the TATA sequence. All three UASI elements bind protein(s); protein binding does not require arginine or overproduction of any of the putative arginine pathway regulatory proteins. The UASI-protein complex was also observed even when extracts were derived from arg80/argRI or arg81/argRII deletion mutants. Similar sequences situated upstream of ARG5,6 and ARG3 and reported to negatively regulate their expression are able to functionally substitute for the CAR1 UASI elements and mediate reporter gene expression.

A constitutive enhancer in the bovine papillomavirus upstream regulatory region shares genetic elements with the viral P1 promoter.

Bream, G L; Vaillancourt, P; Botchan, M R
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em /12/1992 EN
Relevância na Pesquisa
532.9449%
The bovine papillomavirus upstream regulatory region represents a common element in the regulation of transcription from the five early viral promoters. We have determined the sequences required for transcription from the viral P1 promoter, which is located at the 5' end of the upstream regulatory region. In vitro transcription from P1 requires a 123-bp fragment (nucleotides 7153 to 7275; -33 to +90) consisting of an upstream TATA-like sequence as well as an unidentified protein which binds to sequences immediately downstream of the initiation site. In vivo, this promoter requires additional downstream sequences (to position +160; nucleotide 7345) for maximal activity but does not require any additional DNA sequence upstream of a putative TATA box. Four regions within the downstream sequence from +9 to +160 are protected from DNase I digestion by proteins present in a HeLa cell extract. The presence of these sites correlates with the level of P1 activity. A constitutive enhancer maps to this same region, and mutations in this enhancer have been shown to affect downstream promoters. Deletion analysis indicates that the same sequences are required by both the P1 promoter and the constitutive enhancer, suggesting that the same proteins function in both activities.

A 27 kDa protein binds to a positive and a negative regulatory sequence in the promoter of the ICL1 gene from Saccharomyces cerevisiae.

Ordiz, I; Herrero, P; Rodicio, R; Gancedo, J M; Moreno, F
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em 15/01/1998 EN
Relevância na Pesquisa
520.50797%
IsocitrateICL1, is one of the key enzymes of the glyoxylate pathway, which operates as an anaplerotic route for replenishing the tricarboxylic acid cycle; it is required for growth of Saccharomyces cerevisiae on carbon sources such as ethanol, but is dispensable when fermentable carbon sources are available. The positive regulation of the ICL1 gene by an upstream activating sequence (UAS) element located between -397 and -388 has been previously reported. In this paper we show that the ICL1 promoter sequence 5'-AGTCCGGACTAGCATCCCAG-3' located between -261 and -242 contains an upstream repressing sequence (URS) element. We have identified and partially purified a 27 kDa protein that binds specifically to both the UAS and URS sequences of the ICL1 promoter. For both UAS and URS, binding requires the protein Snf1 (Cat1), a protein kinase essential for the derepression of genes repressed by glucose. Binding does not take place with extracts from glucose-grown strains, unless they lack Mig1, a negative regulatory protein involved in glucose repression.

Hepatocyte-stimulating factor, beta 2 interferon, and interleukin-1 enhance expression of the rat alpha 1-acid glycoprotein gene via a distal upstream regulatory region.

Prowse, K R; Baumann, H
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em /01/1988 EN
Relevância na Pesquisa
530.12336%
The rat alpha 1-acid glycoprotein (AGP) gene is transcriptionally regulated by dexamethasone, interleukin 1 (IL-1), hepatocyte-stimulating factor, and beta 2 interferon. The steroid and peptide hormones stimulate expression of the AGP gene synergistically as well as independently. The regulatory sequence responsible for dexamethasone-stimulated expression has been localized previously to a region that is 120 to 64 base pairs (bp) upstream of the transcription start site (H. Baumann and L. E. Maquat, Mol. Cell. Biol. 6:2551-2561, 1986). To identify the regulatory sequence that is responsive to the peptide hormones, different lengths of the AGP gene 5'-flanking DNA were linked to the chloramphenicol acetyltransferase gene and then assayed for hormone-inducible chloramphenicol acetyltransferase gene expression in transiently transfected HepG2 cells. We demonstrate that an enhancer region that is responsive to IL-1, hepatocyte-stimulating factor, and beta 2 interferon lies within a 142-bp sequence located 5,300 to 5,150 bp upstream of the transcription start site. This distal regulatory region can confer hormone inducibility to a heterologous promoter; exert its affect in either orientation; and function, to a lesser degree, in nonhepatic but IL-1-responsive cells.

5' upstream sequences of MyD88, an IL-6 primary response gene in M1 cells: detection of functional IRF-1 and Stat factors binding sites.

Harroch, S; Gothelf, Y; Revel, M; Chebath, J
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em 11/09/1995 EN
Relevância na Pesquisa
444.3383%
Transcription regulatory elements have been analyzed in upstream sequences of an Interleukin-6 (Il-6) primary response gene, MyD88. MyD88 2.3 kb mRNA is strongly and persistently induced in the course of myeloleukemic M1 cells differentiation with Il-6. MyD88 cDNA sequences were found in a region of 12 kb of mouse genomic DNA. Using Il-6 treated M1 cell RNAs, two transcription start sites have been localized, approximately 100 bp upstream from the 5' end of the cloned cDNA. We sequenced 1.4 kb of 5' genomic DNA including the first exon. In 5' of mRNA transcription start site, MyD88 nucleotidic sequence is 85% identical to 5' complementary sequences of the rat 3'-ketoacetyl CoA thiolase gene, over 1.2 kb. A DNA element conferring Il-6-inducible transcription to reporter genes, and localized 30 bp upstream of MyD88 first RNA start site, contains overlapping binding sites for cytokine activated transcription factors Stat and for the Interferon Regulatory Factor-1 and -2 (IRF-1 and IRF-2). In vitro binding assays showed that attachment of Stat factors to this element early in Il-6 treatment requires tyrosine kinase activation. IRF1, an activator of transcription, is also induced to bind to this sequence at later times. A model of persistent activation of MyD88 gene through these two types of factors is proposed.

A CRE/ATF-like site in the upstream regulatory sequence of the human interleukin 1 beta gene is necessary for induction in U937 and THP-1 monocytic cell lines.

Gray, J G; Chandra, G; Clay, W C; Stinnett, S W; Haneline, S A; Lorenz, J J; Patel, I R; Wisely, G B; Furdon, P J; Taylor, J D
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em /11/1993 EN
Relevância na Pesquisa
736.77164%
Transfection of U937 and THP-1 cells with a recombinant plasmid, pIL1(4.0kb)-CAT, containing 4 kb of the interleukin 1 beta (IL-1 beta) gene upstream regulatory sequence resulted in inducer-dependent expression of chloramphenicol acetyltransferase activity. Treatment of the transfected cells with various combinations of the inducers lipopolysaccharide, phorbol myristate acetate, and dibutyryl cyclic AMP upregulated the IL-1 beta promoter. In U937 and THP-1 cells, maximum stimulation of both the endogenous IL-1 beta gene and pIL1(4.0kb)-CAT transfectants was observed following treatment with the combination of inducing agents lipopolysaccharide-phorbol myristate acetate-dibutyryl cyclic AMP. This combination of inducing agents was used to identify and study, at the molecular level, some of the regulatory elements necessary for induction of the IL-1 beta gene. A series of 5' deletion derivatives of the upstream regulatory sequence were used in transient transfection assays to identify an 80-bp fragment located between -2720 and -2800 bp upstream of the mRNA start site that was required for induction. Exonuclease III mapping, electrophoretic mobility shift assays (EMSA), and DNA sequence analysis of this region were used to identify a transcription factor binding sequence which contained a potential cyclic AMP response element (CRE/ATF)- and NF-kappa B-like binding site. Site-directed mutagenesis of the CRE/ATF-like site resulted in the loss of binding of a specific factor or factors as determined by EMSA. The loss of binding activity directly correlated with a loss of approximately 75% of promoter activity as determined in transient transfection assays. As determined by EMSA...

Gel mobility shift scanning of pectin-inducible promoter from Penicillium griseoroseum reveals the involvement of a CCAAT element in the expression of a polygalacturonase gene

Ribon,Andréa de O.B.; Ribeiro,João Batista; Gonçalves,Daniel B.; Queiroz,Marisa V. de; Araújo,Elza F. de
Fonte: Sociedade Brasileira de Genética Publicador: Sociedade Brasileira de Genética
Tipo: Artigo de Revista Científica Formato: text/html
Publicado em 01/01/2009 EN
Relevância na Pesquisa
940.2764%
Previous reports have described pgg2, a polygalacturonase-encoding gene of Penicillium griseoroseum, as an attractive model for transcriptional regulation studies, due to its high expression throughout several in vitro growth conditions, even in the presence of non-inducing sugars such as sucrose. A search for regulatory motifs in the 5' upstream regulatory sequence of pgg2 identified a putative CCAAT box that could justify this expression profile. This element, located 270 bp upstream of the translational start codon, was tested as binding target for regulatory proteins. Analysis of a 170 bp promoter fragment by electrophoretic mobility shift assay (EMSA) with nuclear extracts prepared from mycelia grown in pectin-containing culture medium revealed a high mobility complex that was subsequently confirmed by analyzing it with a double-stranded oligonucleotide spanning the CCAAT motif. A substitution in the core sequence for GTAGG partially abolished the formation of specific complexes, showing the involvement of the CCAAT box in the regulation of the polygalacturonase gene studied.

Identification and functional validation of a 5' upstream regulatory sequence in the human tyrosinase gene homologous to the locus control region of the mouse tyrosinase gene

Regales, Lucía; Giraldo, Patricia; García-Díaz, Ángel; Lavado, Alfonso J.; Montoliu, Lluís
Fonte: Blackwell Publishing Publicador: Blackwell Publishing
Tipo: Artículo Formato: 506038 bytes; application/pdf
ENG
Relevância na Pesquisa
1157.4196%
8 pages, 4 figures.-- PMID: 14629727 [PubMed].; Comparison analysis of the sequences of the mouse and human genomes has proven a powerful approach in identifying functional regulatory elements within the non-coding regions that are conserved through evolution between homologous mammalian loci. Here, we applied computational analysis to identify regions of homology in the 5' upstream sequences of the human tyrosinase gene, similar to the locus control region (LCR) of the mouse tyrosinase gene, located at −15 kb. We detected several stretches of homology within the first 30 kb 5' tyrosinase gene upstream sequences of both species that include the proximal promoter sequences, the genomic region surrounding the mouse LCR, and further upstream segments. We cloned and sequenced a 5' upstream regulatory sequence found between −8 and −10 kb of the human tyrosinase locus (termed h5'URS) homologous to the mouse LCR sequences, and confirmed the presence of putative binding sites at −9 kb, homologous to those described in the mouse tyrosinase LCR core. Finally, we functionally validated the presence of a tissue-specific enhancer in the h5'URS by transient transfection analysis in human and mouse cells, as compared with homologous DNA sequences from the mouse tyrosinase locus. Future experiments in cells and transgenic animals will help us to understand the in vivo relevance of this newly described h5'URS sequence as a potentially important regulatory element for the correct expression of the human tyrosinase gene.; This work was supported by funds from Spanish Ministry of Science and Technology (SMST) Bio2000-1653...