Página 1 dos resultados de 15359 itens digitais encontrados em 0.024 segundos

"Vigilância epidemiológica de vírus respiratórios humanos em amostras clínicas pela técnica de genescan-RT-PCR" ; GeneScan Reverse Transcription-PCR assay for surveillance of respiratory viruses in clinical samples of pediatric patients in Brazil

Thomazelli, Luciano Matsumiya
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Dissertação de Mestrado Formato: application/pdf
Publicado em 06/12/2004 PT
Relevância na Pesquisa
66.44%
As doenças respiratórias agudas (DRAs) são as causas mais comuns de morbidez e mortalidade infantil mundial, podendo ser causadas por uma grande variedade de microorganismos. A fim de se detectar os vírus respiratórios mais comumente associados às infecções agudas do trato respiratório e traçar seu perfil epidemiológico, utilizamos um protocolo de GS RT-PCR (GeneScan Transcrição Reversa-Reação em Cadeia da Polimerase) para a rápida detecção simultânea do, vírus influenza A e B, parainfluenzavirus tipo 1, 2 e 3, picornavirus, metapneumovirus e o adenovírus. As amostras clínicas foram colhidas de crianças menores de cinco anos de idade, apresentando sintomas respiratórios, no Hospital Universitário (HU) da Universidade de São Paulo (USP), durante o ano de 2003. O GS RT-PCR se mostrou uma metodologia sensível e específica, capaz de detectar uma diversidade maior de agentes infecciosos do trato respiratório em relação à Imunofluorescência Indireta (IFI), reduzindo neste estudo a porcentagem de amostras negativas de 69,9% (235 amostras) para 22% (74 amostras).; A reverse transcription polymerase chain reaction (RT-PCR) assay based on automated fluorescent capillary electrophoresis and GeneScan software analysis was used to detect nine common respiratory viruses in clinical specimens from young children. Assays for human respiratory syncytial virus (HRSV)...

Estudo da expressão dos genes HOXB13 e HHEX em carcinomas epidermóides de boca através das técnicas de RT-PCR e Hibridização in situ.; HOXB13 and HHEX expression study in oral squamous cell carcinoma with the RT-PCR and in situ Hybridization techniques.

Cazal, Claudia
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Tese de Doutorado Formato: application/pdf
Publicado em 13/12/2004 PT
Relevância na Pesquisa
66.48%
O presente estudo teve o objetivo de verificar o padrão de expressão dos genes HOXB13 e HHEX em carcinomas epidermóides de boca (CEB) através das técnicas de Transcriptase Reversa em Reação de Cadeia Polimerase (RT- PCR) e Hibridização In situ (ISH). Fragmentos de tecido tumoral e de tecido não tumoral adjacente à lesão foram obtidos de 30 pacientes portadores de CEB no Serviço de Cirurgia de Cabeça e Pescoço do HC - FMUSP. As amostras tiveram seus cDNAs extraí dos e submetidos à amplificação por PCR. Os “ amplicons” foram visualizados sob luz UV por eletroforese em gel de agarose a 1% contendo brometo de etí dio. A amplificação dos genes foram correlacionadas com a classificação UICC, TNM, graduação histológica, localização e espessura tumoral, invasão de tecidos adjacentes, perineural e vascular. Após seqüenciamento dos “ amplicons” e confirmação dos genes foram confecionadas as sondas de mRNA para realização da técnica de hibridização in situ. Os resultados obtidos através da técnica de RT-PCR mostraram que: a amplificação dos transcritos dos genes HOXB13 e HHEX podem ser detectados tanto no carcinoma epidermóide quanto no tecido não tumoral adjacente à lesão; não existindo diferença na amplificação dos transcritos de ambos genes para os dois grupos de tecido estudados; a amplificação do transcrito do gene HOXB13 mostrou relação estatí stica com os fatores prognósticos: espessura tumoral...

Ocorrência de Theileria equi congênita em potros Puro Sangue Lusitano no Brasil, diagnosticada através da técnica de RT-PCR; Occurrence of congenital Theileria equi in Lusitano foals through RT-PCR detection

Roncati, Neimar Vanderlei
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Tese de Doutorado Formato: application/pdf
Publicado em 12/12/2006 PT
Relevância na Pesquisa
66.44%
Para determinação da ocorrência de transmissão transplacentária da Theileria equi em neonatos eqüinos foram avaliados 50 potros da raça Puro Sangue Lusitano, machos e fêmeas, bem como suas respectivas mães, logo após o parto. Foram colhidas amostras de sangue total, tanto das mães como dos neonatos, entre as primeiras cinco horas pós parto para pesquisa de Theileria equi e Babesia caballi através da técnica de RT-PCR. Utilizou-se o kit de detecção baseado no fluofóro intercalante de DNA SYBERgreen. Um total de 46% das éguas apresentaram resultado positivo para Theileira equi e 54% se mostraram negativas, enquanto que 66% dos potros apresentaram resultados positivos e 34% negativos, sendo que 73,9% dos potros positivos nasceram de mães também positivas. Já para Babesia caballi, 16% das éguas foram positivas e 84% negativas, assim como 2% dos potros foram positivos e 98% negativos. O teste de RT-PCR é bastante sensível e específico, mas pode resultar em falso negativo, apesar de ser eficaz na detecção da Theileria equi e Babesia caballi nos eqüinos. Estes dados permitem concluir que existe a possibilidade de transmissão transplacentária de Theileria equi.; The occurrence of transplacentary transmission of Theileria equi in horses was determined by evaluating 50 young male and female horses of the breed Lusitano Horses as well as their respective mothers. Colts and fillies were evaluated as soon as they were born. Total blood samples were collected from both mother and offspring within the first five hours right after the parturition to analyse Theileria equi and Babesia caballi through the RT-PCR technique. It was used the kit of detection based on DNA SYBERgreen. This study showed us that 46% of the female horses had positive results for Theileira equi and 54% negative results while 66% of the male horses had positive results and 34% of them...

Detecção e tipificação do vírus da dengue por RT-PCR em tempo real; Detection and typing of dengue virus by real time RT-PCR assays

Poloni, Telma Regina Ramos Silva
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Dissertação de Mestrado Formato: application/pdf
Publicado em 28/05/2009 PT
Relevância na Pesquisa
66.55%
A dengue é uma doença infecciosa de transmitida pela picada de mosquitos do gênero Aedes. O vírus da dengue (DENV), pertencente ao gênero Flavivirus, família Flaviviridae, é atualmente um importante problema de saúde pública em todo o mundo. São reconhecidos quatro sorotipos antigenicamente distintos (DENV-1, -2, -3 e -4). A doença causada por qualquer um dos sorotipos cursa de forma assintomática ou com quadro clínico que varia desde uma febre indiferenciada e autolimitada, passando pela febre clássica da dengue (FD) até quadros graves de febre hemorrágica da dengue (DHF). O diagnóstico clínico é difícil de ser realizado principalmente na fase aguda da doença em que os sintomas são muito similares aos de outras infecções febris agudas, ficando a cargo do laboratório o diagnóstico definitivo. Os métodos sorológicos para detecção de anticorpos IgM/IgG são os mais amplamente utilizados, mas inadequados para diagnóstico precoce uma vez que detectam anticorpos a partir do sexto dia do início dos sintomas. Os métodos moleculares estão sendo cada vez mais utilizados para o diagnóstico precoce por serem mais rápidos e sensíveis que a sorologia e o isolamento viral. Neste estudo comparamos a sensibilidade de uma RT-PCR em tempo real gênero específica com um ELISA para detecção da proteína NS1 comercialmente disponível analisando amostras de soro de pacientes com dengue. Também foram desenvolvidos dois protocolos de RT-PCR em tempo real para identificação do sorotipo viral...

Diagnóstico da raiva e das encefalites equinas do Leste e Oeste em equídeos pelo emprego da técnica de multiplex hemi-nested RT-PCR; Diagnosis of rabies and Eastern and Western Equine Viral Encephalitides in equids by multiplex hemi-nested RT-PCR technique

Iamamoto, Keila
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Tese de Doutorado Formato: application/pdf
Publicado em 10/10/2011 PT
Relevância na Pesquisa
66.6%
Várias zoonoses virais acometem equídeos causando quadros neurológicos, entre as quais a raiva e as encefalites equinas do Leste (EEE) e Oeste (WEE). O diagnóstico clínico geralmente não é conclusivo, o que torna imprescindível o diagnóstico laboratorial. Dados do Laboratório de Diagnóstico de Raiva do Instituto Pasteur de São Paulo, entre os anos 2000 e 2010, mostram que aproximadamente 75% das amostras enviadas foram negativas para raiva, ressaltando a relevância da realização de um diagnóstico diferencial para as encefalites equinas causadas por alfavírus. Os objetivos do estudo foram testar a adequação do uso de multiplex hemi-nested RT-PCR para o diagnóstico de raiva, EEE e WEE em amostras de sistema nervoso central de equídeos e realizar uma análise de custo das reações de cada técnica. Foram utilizados os primers 21G, 304 e 504 dirigidos ao gene N do vírus da raiva, e os primers cM3W, M2W, nEEE e nWEE dirigidos ao gene NSP1 dos vírus da EEE e WEE. Procedeu-se a um estudo preliminar dos primers e de seu uso em uma hemi-nested RT-PCR, avaliando a temperatura ótima de anelamento, a sensibilidade e especificidade analíticas e a reprodutibilidade da técnica em amostras de campo positivas para raiva e para EEE. A partir do protocolo estabelecido na reação de hemi-nested RT-PCR...

Detecção do vírus da raiva em órgãos de morcegos do gênero Artibeus (Leach, 1821) por meio de RT-PCR, Hemi-Nested RT-PCR e Real Time RT-PCR; Detection of rabies virus in organs of bats of the genus Artibeus (Leach, 1821) using RT-PCR, Hemi- Nested RT-PCR and Real Time RT-PCR

Ferreira, Karin Correa Scheffer
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Tese de Doutorado Formato: application/pdf
Publicado em 30/08/2011 PT
Relevância na Pesquisa
66.6%
Este estudo teve como objetivo detectar a presença do vírus da raiva em diferentes órgãos de morcegos do gênero Artibeus empregando as técnicas moleculares como RT-PCR, hnRT-PCR e Real Time RT-PCR. De aproximadamente 4000 espécimes de morcegos recebidas no Instituto Pasteur para o diagnóstico da raiva, foram selecionados 30 morcegos do gênero Artibeus, com resultados positivos para raiva pelas técnicas tradicionais de IFD e inoculação em células N2A utilizando suspensões feitas a partir do SNC. Para as técnicas moleculares, foram retirados glândulas salivares, bexigas urinárias, rins, pulmões e conteúdos fecais e ainda foram lavadas as calotas cranianas dos espécimes. Os órgãos e conteúdos fecais foram diluídos a 1:10 (P/V) e as bexigas urinárias a 1:20 (P/V). As suspensões foram inoculadas em células N2A para o isolamento viral. Foi realizada a extração do RNA total usando o TRIzol®, foram realizadas a transcrição reversa seguida da PCR e hnRT-PCR com utilização de primers específicos para o gene codificante da proteína N. A partir do produto da transcrição reversa foi realizada a técnica de Real Time RT-PCR, utilizando primers e sonda específicos para variante antigênica 3. Das 30 suspensões de lavado cerebral...

Desenvolvimento de técnicas de RT-PCR para seqënciamento do gene da hemaglutinina-neuraminidase (HN) e detecção do vírus Parainfluenza bovino tipo 3; Development of RT-PCR techniques for hemagglutinin-neuraminidase (HN) gene sequencing and detection of bovine type 3 Parainfluenza virus

Vaucher, Rodrigo de Almeida
Fonte: Universidade Federal do Rio Grande do Sul Publicador: Universidade Federal do Rio Grande do Sul
Tipo: Dissertação Formato: application/pdf
POR
Relevância na Pesquisa
66.52%
Existem diversos trabalhos publicados sobre a utilização de diferentes métodos imunológicos para diagnosticar infecções do trato respiratório causadas por vírus parainfluenza bovino tipo 3 (bPIV-3). Entretanto, é escassa a literatura sobre a utilização da técnica de isolamento viral. Até o presente momento não havia sido relatada a utilização da Transcrição Reversa - Reação em Cadeia da Polimerase (RT-PCR), na detecção de bPIV-3. O objetivo deste estudo foi contribuir para uma melhor caracterização dos bPIV-3 através do desenvolvimento de técnicas de RTPCR para a sua detecção. Utilizando-se uma amostra referência de bPIV-3 (SF-4) e uma amostra de bPIV-3 isolada no Rio Grande do Sul (amostra DIO) foram desenvolvidas técnicas de RT-PCR para a amplificação de diferentes regiões do gene da hemaglutinina-neuraminidase (HN). Após seqüenciamento parcial do gene HN e alinhamento das seqüências da amostra DIO, os resultados revelaram homologia de 99% em relação à amostra referência, 98% a 91% quando comparada com outras amostras de bPIV-3 previamente publicadas na rede e 79% a 80% quando comparada com as amostras de hPIV-3. Foi desenvolvida, também, uma técnica de RT-PCR para amplificação de parte do gene da HN do bPIV-3 e do hPIV-3. Nos experimentos de otimização...

RT-PCR for detection on bovine parainfluenza virus type 3 (bPIV-3); RT-PCR para detecção do vírus parainfluenza bovino tipo 3 (bPIV-3)

Vaucher, Rodrigo de Almeida; Simonetti, Amauri Braga; Roehe, Paulo Michel
Fonte: Universidade Federal do Rio Grande do Sul Publicador: Universidade Federal do Rio Grande do Sul
Tipo: Artigo de Revista Científica Formato: application/pdf
ENG
Relevância na Pesquisa
66.47%
A técnica de RT-PCR tem sido freqüentemente utilizada para a detecção do vírus parainfluenza humano tipo 3 (hPIV- 3), mas a literatura é escassa em relação ao vírus parainfluenza bovino tipo 3 (bPIV-3) .O objetivo deste trabalho foi descrever uma técnica de reação em cadeia pela polimerase, precedida de transcrição reversa (RT-PCR), para a detecção do vírus parainfluenza bovino tipo 3 (bPIV-3), usando oligonucleotídeos degenerados para uma região conservada do gene da hemaglutininaneuraminidase (HN). A amostra-referência SF-4 e três diferentes isolados brasileiros de bPIV-3, além de cinco amostras virais de diferentes origens, foram incluídos neste estudo. Os vírus foram cultivados em células MDBK sob condições padronizadas. O teste de hemaglutinação (HA) foi utilizado para a titulação viral, e o teste de imunofluorescência direta (DFTA) para a triagem dos isolados. Na RT-PCR, todos os isolados de bPIV-3 mostraram amplificação de um fragmento esperado de 1009 pb do gene HN, ao contrário do que aconteceu com as amostras virais não bPIV-3, onde não foi detectada amplificação. Empregando a amostra SF-4 como controle positivo, foi obtida uma sensibilidade de 95 pg de cDNA. Apesar do pequeno número de amostras de bPIV- 3 testadas...

Infectious bronchitis virus: detection and vaccine Strain differentiation by semi-nested RT-PCR

Okino, CH; Montassier, MFSM; Givisiez, PEN; Furuyama, CRAG; Brentano, L; Montassier, Helio Jose
Fonte: Fundação APINCO de Ciência e Tecnologia Avícolas Publicador: Fundação APINCO de Ciência e Tecnologia Avícolas
Tipo: Artigo de Revista Científica Formato: 59-66
ENG
Relevância na Pesquisa
66.46%
A semi-nested reverse transcription-polymerase chain reaction (Semi-N-RT-PCR) was developed and used to detect the S glycoprotein gene of infectious bronchitis virus (IBV) strains and to discriminate H120 vaccine strain from other strains. Viral RNA was extracted from the allantoic fluid of chicken embryos and from tissues of chickens experimentally infected with different strains of IBV. Amplification and identification of the viral RNA was performed using two sets of primers complementary to a region of the S glycoprotein gene in the Semi-N-RT-PCR assay. The pair of primers used in the first PCR consisted of universal oligonucleotides flanking a more variable region of S1-S2 gene. The second primer pair was used in the Semi-N-RT-PCR and was comprised of one of the primers from the first universal pair together with either another universal internal oligolucleotide or a oligonucleotide sequence specific for the H120 strain of IBV. The universal primers detected all reference IBV strains and field isolates tested herein. The Semi-N-RT-PCR had high sensitivity and specificity, and was able to differentiate the H120 vaccine strain from other reference IBV strains; including M41 strain. All tissue samples collected from chickens experimentally infected with H120 or M41 strains were positive in the semi-nested RT-PCR using universal primers...

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Dantas, Bárbara França; Aragão, Carlos Alberto; Araújo-Junior, João Pessoa; Rodrigues, João Domingos; Cavariani, Cláudio; Nakagawa, João
Fonte: Associação Brasileira de Tecnologia de Sementes (ABRATES) Publicador: Associação Brasileira de Tecnologia de Sementes (ABRATES)
Tipo: Artigo de Revista Científica Formato: 113-117
POR
Relevância na Pesquisa
66.47%
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.; During germination the seed reserve carbohydrates are degraded by alpha-amylase activity. The identification of mRNA is a very important tool for definition of alpha-amylase synthesis kinetics. This study aimed to adapt a PT-PCR methodology for a-identification of amylase mRNA in germinating maize seeds. After three days germination of Saracura BRS4154 and CATI AL34 maize cultivars...

Imunocaptura do vírus de Influenza aviária para dia diagnóstico em RT-PCR em tempo real

Di Pillo, Fulvia
Fonte: Universidade Estadual Paulista (UNESP) Publicador: Universidade Estadual Paulista (UNESP)
Tipo: Dissertação de Mestrado Formato: xiv, 55 f. : il.
POR
Relevância na Pesquisa
66.53%
Pós-graduação em Microbiologia Agropecuária - FCAV; A técnica de imunocaptura associada com a reação de transcrição reversa e reação em cadeia da polimerase (IC-RT-PCR) executadas tanto pelos procedimentos convencional como em tempo real foram testadas para a detecção rápida do gene da glicoproteína de Matriz (M) do vírus de influenza aviária (AIV) em amostras de líquido cório-alantóide (LCA) e em suabes traqueais e cloacais. O presente trabalho teve como objetivo desenvolver e otimizar a técnica de IC-RT-PCR para o diagnóstico do vírus da Influenza aviária. Os resultados obtidos foram comparados com um sistema empregando “beads” magnéticas em microplacas (AMBION), que é o método padrão de extração de RNA usado no laboratório de referência para diagnóstico de influenza aviária, o National Veterinary Services Laboratory – Ames, EUA (USDA), acrescido ainda de outros métodos de extração tradicionalmente usados nos laboratórios de referência para AIV, como os procedimentos com o uso do solvente orgânico Trizol® (Invitrogen) e com um sistema robotizado e que utiliza “beads” magnéticas (MagNA Pure - ROCHE). A técnica de IC-RT-PCR em tempo real neste estudo detectou a estirpe H2N2 do AIV...

Comparative evaluation of conventional RT-PCR and real-time RT-PCR (RRT-PCR) for detection of avian metapneumovirus subtype A

Ferreira,Helena Lage; Spilki,Fernando Rosado; Santos,Márcia Mercês Aparecida Bianchi dos; Almeida,Renata Servan de; Arns,Clarice Weis
Fonte: Universidade Federal de Santa Maria Publicador: Universidade Federal de Santa Maria
Tipo: Artigo de Revista Científica Formato: text/html
Publicado em 01/08/2009 EN
Relevância na Pesquisa
66.5%
Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an established test for the attachment (G) gene. All the RT-PCR tested assays were able to detect the AMPV/A. The lower detection limits were observed using the N-, F- based RRT-PCR and F-based conventional RT-PCR (10(0.3) to 10¹ TCID50 mL-1). The present study suggests that the conventional F-based RT-PCR presented similar detection limit when compared to N- and F-based RRT-PCR and they can be successfully used for AMPV/A detection.

Infectious bronchitis virus: detection and vaccine Strain differentiation by semi-nested RT-PCR

Okino,CH; Montassier,MFSM; Givisiez,PEN; Furuyama,CRAG; Brentano,L; Montassier,HJ
Fonte: Fundação APINCO de Ciência e Tecnologia Avícolas Publicador: Fundação APINCO de Ciência e Tecnologia Avícolas
Tipo: Artigo de Revista Científica Formato: text/html
Publicado em 01/03/2005 EN
Relevância na Pesquisa
66.46%
A semi-nested reverse transcription-polymerase chain reaction (Semi-N-RT-PCR) was developed and used to detect the S glycoprotein gene of infectious bronchitis virus (IBV) strains and to discriminate H120 vaccine strain from other strains. Viral RNA was extracted from the allantoic fluid of chicken embryos and from tissues of chickens experimentally infected with different strains of IBV. Amplification and identification of the viral RNA was performed using two sets of primers complementary to a region of the S glycoprotein gene in the Semi-N-RT-PCR assay. The pair of primers used in the first PCR consisted of universal oligonucleotides flanking a more variable region of S1-S2 gene. The second primer pair was used in the Semi-N-RT-PCR and was comprised of one of the primers from the first universal pair together with either another universal internal oligolucleotide or a oligonucleotide sequence specific for the H120 strain of IBV. The universal primers detected all reference IBV strains and field isolates tested herein. The Semi-N-RT-PCR had high sensitivity and specificity, and was able to differentiate the H120 vaccine strain from other reference IBV strains; including M41 strain. All tissue samples collected from chickens experimentally infected with H120 or M41 strains were positive in the semi-nested RT-PCR using universal primers...

Detection of bovine coronavirus by RT-PCR in a field study

Khalili, M.; Morshedi, A.; Keyvanfar, H.; Hemmatzadeh, F.
Fonte: Univ Zagreb Vet Faculty Publicador: Univ Zagreb Vet Faculty
Tipo: Artigo de Revista Científica
Publicado em //2006 EN
Relevância na Pesquisa
66.45%
In the present study we used RT-PCR assay for detecting of BCoV, targeting a 730 bp fragment of the nucleocapsid (N) gene of BCoV with published primers that could amplify all BCoV strains. We evaluated presence of BCoV in diarrheic and nondiarrheic samples. 108 faecal samples from diarrheic calves and 80 faecal samples from nondiarrheic calves collected. In 13 of 108 diarrheic samples both ELISA and RT-PCR detected BCoV. In 4 of 80 samples second group (non diarrheic) BCoV was detected by RT-PCR only not capture ELISA. This report is the first detection of BCoV in Iran. The results suggest that RT-PCR is more sensitive than ELISA method to detect BCoV, especially in subclinical cases. Because these animals shed a low amount of virus in faeces we need to apply sensitive techniques, such as RT-PCR, nested PCR and real time RT-PCR.; http://www.vef.unizg.hr/vetarhiv/get_papers.php?a=i&y=2006&v=76&n=4&s=0; Mohammad Khalili, Ahmad Morshedi, Hadi Keyvanfar and Farhid Hemmatzadeh

Etablierung und Evaluierung einer Real-time RT-PCR zur quantitativen Analyse der Genexpression von 7 humanen Zytokinen; Etablierung und Evaluierung einer Real-time RT-PCR zur quantitativen Analyse der Genexpression von 7 humanen Zytokinen; Establishment and evaluation of a real-time RT-PCR for quantitative gene expression analysis of 7 human cytokines

Swatoch, Phillipp Christopher
Fonte: Universidade de Tubinga Publicador: Universidade de Tubinga
Tipo: Dissertação
DE_DE
Relevância na Pesquisa
66.54%
Über den quantitativen Nachweis der Zytokin-Produktion unter pathologischen Bedingungen lassen sich Informationen über die stattfindenden Immunprozesse gewinnen. Die relativ neue Technik der Real-time RT-PCR wird dabei wegen ihrer leichten Durchführbarkeit, hohen Sensitivität, Spezifität und Reproduzierbarkeit zunehmend zur Quantifizierung der Zytokin-Genexpression eingesetzt. In der vorliegenden Arbeit wurde im LightCycler Instrument unter Anwendung eines identischen Reaktionsansatzes und eines konstanten PCR-Protokolls ein Real-time RT-PCR-Assay zur absoluten Quantifizierung der mRNA-Expression für die folgende Auswahl an Zytokinen etabliert: IL-4, IL-8, IL-10, IL-12, IL-18, TNF-alpha sowie IFN-gamma. Sie sind neben anderen Zytokinen wesentlich an der Pathophysiologie von Komplikationen nach allogener hämatopoetischer Stammzelltransplantation (SZT) beteiligt. Für die einzelnen Zytokine wurden externe Standards generiert, die eine absolute Quantifizierung ermöglichen. Über den Einsatz der Standards in die Light-Cycler RT-PCR wurde die Methode evaluiert. Es zeigte sich dabei zu anderen Real-time RT-PCR-Assays eine vergleichbare Reproduzierbarkeit sowie eine hohe Sensitivität für die verschiedenen Zytokine (Detektionslimit IL-4...

Vergleich einer neuen RT-PCR-basierten Methode zum Nachweis disseminierter Tumorzellen im Knochenmark von Mammakarzinompatientinnen mit Immunzytochemie; Comparison of a new RT-PCR-based detection of disseminated tumor cells in breast cancer patients with immunocytochemistry

Banys, Malgorzata Joanna
Fonte: Universidade de Tubinga Publicador: Universidade de Tubinga
Tipo: Dissertação
DE_DE
Relevância na Pesquisa
66.55%
Tumorzelldissemination ist ein wichtiger Schritt im komplexen Prozess der Metastasierung. Die klinische Relevanz der disseminierten Tumorzellen im Knochenmark sowie ihr Einfluss auf die Prognose von Mammakarzinompatientinnen wurden in zahlreichen Studien und einer Metaanalyse demonstriert (Level-1-Evidenz). Die Ziele der vorliegenden Studie waren einerseits die Evaluation einer neu etablierten RT-PCR-basierten Methode zum Nachweis der Tumorzelldissemination in der klinischen Routine und andererseits ihr Vergleich mit dem antikörperbasierten Goldstandard (Immunzytochemie). Die von uns verwendete real-time „One-Step” RT-PCR basierte auf der Hybridisierungssonden-Technologie und amplifizierte die in epithelialen Zellen üblicherweise vorhandene Zytokeratin 19-mRNA. Knochenmarkaspirate von 405 Mammakarzinompatientinnen wurden mittels Immunzytochemie (ICC) und RT-PCR untersucht. Immunzytochemisch ließen sich bei 34% aller Patientinnen disseminierte Tumorzellen nachweisen. Die höchste Positivitätsrate (58%) wurde in der Subgruppe der Patientinnen mit Rezidiv / Metastasierung beobachtet. Hingegen blieben 20% der Patientinnen ohne Hinweis auf Reaktivierung der Erkrankung (Kontrollpunktionen) positiv. 142 von 405 (35%) Knochenmarkaspiraten wurden mittels qualitativer RT-PCR als positiv beurteilt. Die höchste Positivitätsrate ergab sich im Kollektiv der neoadjuvant vorbehandelten Patientinnen (48%)...

Estudo evolutivo dos hantavírus e desenvolvimento de uma RT-PCR quantitativa em tempo real para detecção do vírus Araraquara; Evolutionary study of Hantavirus and development of a quantitative real time RT-PCR for detection of Araraquara virus

Souza, William Marciel de
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Dissertação de Mestrado Formato: application/pdf
Publicado em 28/03/2013 PT
Relevância na Pesquisa
66.48%
O gênero Hantavírus está incluído na família Bunyaviridae que são vírus emergentes associados a roedores que podem infectar o homem causando graves doenças. Nas Américas, os Hantavírus causam uma síndrome pulmonar e cardiovascular (SPCVH) com alta letalidade. Cerca de 1600 casos de SPCVH já foram notificados no Brasil causando mais de 600 óbitos. Sete espécies de Hantavírus são conhecidas no Brasil incluindo o vírus Araraquara que circula nas regiões de cerrado do país associado ao roedor Necromys lasiurus. Para o desenvolvimento de uma RT-PCR em tempo real para detecção e quantificação de Hantavírus, mostramos as etapas para o desenvolvimento de uma one-step RT-PCR em tempo real SYBR Green I para Hantavírus Araraquara que se mostrou específica para o gênero e capaz de detectar até 10 cópias por mL de RNA viral na amostra. Além disso, realizamos um estudo filogenético utilizando algoritmos bayesianos, com 190 sequências completas do gene da nucleoproteína, oriundas de 30 países durante um período de 25 anos (1985-2010) que encontravam-se disponíveis no GenBank (NCBI). Baseando-se em uma taxa média de 6.8 x 10-4 (2.5 x 10-4 - 1 x 10-3) substituições nucleotídicas por sítio/ano, foi possível inferir que os Hantavírus teriam aproximadamente 1917 anos. O processo de dispersão dos Hantavírus pelo mundo teria ocorrido há aproximadamente 500 anos...

Encefalomielite na cinomose canina : estudo prospectivo dos achados clinicos, histologicos e da RT-PCR; Encephalomyelitis in canine distemper : prospective study of clinical, histological and RT-PCR findings

Edson Martins Scarpelli
Fonte: Biblioteca Digital da Unicamp Publicador: Biblioteca Digital da Unicamp
Tipo: Dissertação de Mestrado Formato: application/pdf
Publicado em 27/08/2008 PT
Relevância na Pesquisa
66.5%
A cinomose canina (CC) é uma doença viral sistêmica de carnívoros, cujo diagnóstico é embasado em sinais neurológicos e extra-neurais. A desmielinização que ocorre nesta doença assemelha-se à das doenças desmielinizantes humanas, o que a torna um modelo animal para estudo de doenças neurodegenerativas humanas. Lesões iniciais do SNC caracterizam-se por desmielinização sem considerável inflamação e lesões tardias por um processo inflamatório crônico. Vários métodos são empregados para o diagnóstico da CC, destacando-se a RT-PCR como precisa e sensível. Estudar, prospectivamente, os achados clínicos e histopatológicos do cérebro de 49 cães com cinomose diagnosticada clinicamente, e confrontá-los com os resultados da RT-PCR foi o nosso objetivo. A presença de sinais neurológicos foi significante para o diagnóstico da doença, especialmente a mioclonia e ataxia. O comprometimento inflamatório era significante no cerebelo, hipocampo e diencéfalo sendo que a reação inflamatória era maior no diencéfalo. Quanto maior o peso cerebral, menor era a desmielinização. Nos animais na fase clínica aguda, a freqüência de desmielinização cerebelar foi maior. Foi significante a localização linização...

Reação de hemi-nested RT-PCR dirigida ao gene da hemaglutinina-esterase do Coronavírus Bovino; A semi-nested RT-PCR assay targeted to hemagglutinin-esterase gene of Bovine Coronavirus

Souza, Sibele Pinheiro de; Asano, Karen Miyuki; Buitrago, Laura Yaneth Villarreal; Silva, Sheila de Oliveira Souza; Richtzenhain, Leonardo José; Brandão, Paulo Eduardo
Fonte: Universidade de São Paulo. Faculdade de Medicina Veterinária e Zootecnia Publicador: Universidade de São Paulo. Faculdade de Medicina Veterinária e Zootecnia
Tipo: info:eu-repo/semantics/article; info:eu-repo/semantics/publishedVersion; ; ; ; ; ; Formato: application/pdf
Publicado em 01/01/2010 ENG
Relevância na Pesquisa
66.49%
O coronavírus bovino (BCoV) é um vírus RNA simples fita, de sentido positivo, não segmentado com envelope constituído de uma camada dupla de lipídios com quatro proteínas (HE, S, E e M) que resultam no aspecto de coroa dos vírions. Como a HE (hemaglutinina-esterase) é uma proteína polimórfica com uma função de receptor aglutinante secundária, estudos sobre a diversidade do gene HE podem possibilitar maiores informações sobre a evolução e interação hospedeiro-parasita do BCoV. Uma reação de hemi-nested RT-PCR foi desenvolvida para a amplificação de um produto de 441pb do gene HE do BCoV (nt 543 ao 562). Temperaturas ótimas de hibridização foram testadas em um termociclador com gradiente para a reação de hemi-nested e utilizada no protocolo final. A sensibilidade analítica foi determinada por meio da diluição serial na base 10 do BCoV amostra Kakegawa (título HA: 256) em uma suspensão fecal negativa para BCoV, resultando positiva até a diluição de 10-6, mostrando uma alta sensibilidade analítica sem inibição na PCR. O protocolo final da hemi-nested RT-PCR foi aplicado a 21 amostras fecais de vacas previamente positivas para BCoV e o sequenciamento de DNA do produto de 441pb de 14 amostras resultaram em sequências com elevado escore do gene HE do BCoV após a análise no BLAST/n. Essa hemi-nested RT-PCR é uma ferramenta poderosa para estudos de diversidade filogenética de linhagens de campo de BCoV e para estudos comparativos entre os diferentes genes dos Coronavírus.; Bovine coronavirus (BCoV) is a non-segmented positive-sense single-stranded RNA virus whose envelope is constituted by a lipid bilayer with four structural proteins (HE...

Detección por RT-PCR Punto Final y Tiempo Real de Tres Especies de Viroides en Cítricos de Nuevo León y Tamaulipas, México

Guerrero Gámez,César Enrique; Alvarado Gómez,Omar Guadalupe; Gutiérrez Mauleón,Hazael; González Garza,Ramiro; Álvarez Ojeda,María Genoveva; Luna Rodríguez,Mauricio
Fonte: Sociedad Mexicana de Fitopatología A.C. Publicador: Sociedad Mexicana de Fitopatología A.C.
Tipo: Artigo de Revista Científica Formato: text/html
Publicado em 01/01/2013 ES
Relevância na Pesquisa
66.47%
Se desarrollaron tres protocolos de RT-PCR tiempo real con el sistema SYBR Green y se compararon con el método convencional RT-PCR punto final para la detección del viroide de la exocortis de los cítricos (CEVd), el viroide del enanismo del lúpulo (HSVd) y el viroide del enanismo de los cítricos (CDVd) tras evaluar distintas combinaciones de iniciadores específicos; adicionalmente se realizó el análisis para los tres viroides referidos en 90 muestras de cítricos colectadas en huertas del noreste de México. Las muestras evaluadas comprendieron diferentes especies colectadas en los municipios de General Terán, Montemorelos y Marín, en Nuevo León, además de Río Bravo, Cd. Victoria e Hidalgo, en Tamaulipas. Se extrajo el ARN total de las muestras, y fueron analizadas mediante las técnicas de RT-PCR múltiple punto final y RT-PCR tiempo real con el sistema SYBR Green. Se detectó la presencia individual y conjunta de los viroides CEVd, HSVd y CDVd en las muestras analizadas. Usando la técnica de RT-PCR tiempo real con SYBR Green, se obtuvo un 41 % de muestras positivas a CEVd, 42 % a HSVd y 49 % al CDVd. Al comparar las técnicas de RT-PCR punto final y tiempo real, se obtuvieron resultados similares.