Página 1 dos resultados de 2177 itens digitais encontrados em 0.005 segundos

Detecção condutométrica sem contato (oscilométrica) para eletroforese capilar de zona e cromatografia micelar eletrocinética; Contactless conductivity detection for capillary zone electrophoresis and micellar electrokinetic chromatography

Silva, José Alberto Fracassi da
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Tese de Doutorado Formato: application/pdf
Publicado em 19/03/2001 PT
Relevância na Pesquisa
Este trabalho descreve a construção e avaliação de um detector condutométrico sem contato (oscilométrico) para sua aplicação em eletroforese capilar de zona e cromatografia micelar eletrocinética (MEKC). A construção do detector contou com a avaliação de diversos materiais e métodos para a confecção dos eletrodos, tão bem como o aperfeiçoamento do seu circuito eletrônico. O seu comportamento e desempenho foram verificados através do estudo dos diversos parâmetros que influenciam sua resposta, como freqüência e amplitude do sinal aplicado, temperatura e condutividade do meio. Além disso, a simulação do circuito equivalente da cela de detecção auxiliou no entendimento das propriedades do detector frente a alterações na condutividade do meio, na freqüência de operação e nas dimensões da cela. A otimização dos parâmetros operacionais foi racionalizada pela formulação de equações analíticas que descrevem o fator de resposta do detector a partir de parâmetros obtidos experimentalmente. Para o desenvolvimento do sistema de detecção, dois equipamentos completos de eletroforese capilar foram construídos. Sistemas de injeção de amostra por pressão, por gravidade, e eletrocinética foram desenvolvidos. Um dos equipamentos permite que a injeção da amostra seja feita do lado aterrado da fonte de alta tensão. Conseqüentemente...

"Desenvolvimento de novos sensores a partir de CD-Rs para análise voltametrica e de métodos de eletroforese capilar para monitoramento de íons em águas"; Development of new sensors from compact disc for voltammetric analysis and electrophoresis methods for monitoring of ions in water

Richter, Eduardo Mathias
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Tese de Doutorado Formato: application/pdf
Publicado em 10/12/2004 PT
Relevância na Pesquisa
Neste trabalho descreve-se o desenvolvimento de metodologias para análise de metais pesados em águas de abastecimento (sistema Guarapiranga) e em água de chuva por métodos voltamétricos, a quantificação de cátions e ânions por eletroforese capilar com detecção condutométrica sem contato (EC-DCC), a construção de eletrodos de prata a partir de CD-Rs e sua aplicação para medidas potenciométricas, amperométricas e voltamétricas, a confecção de microeletrodos de ouro explorando técnicas de micro-fabricação com toner e sua aplicação como detector amperométrico em eletroforese capilar e o uso de máscaras de toner para construção de redes de microeletrodos de ouro, platina e carbono. Para o desenvolvimento de metodologia para monitorar chumbo, cobre e mercúrio em águas de abastecimento e em água de chuva, enfatizou-se a utilização de dispositivos semidescartáveis de ouro construídos a partir de CD-Rs utilizando técnicas eletroanalíticas de redissolução. O limite de detecção para 300 s de pré-concentração foi calculado em 80, 90 e 100 ng L-1 para Pb2+, Cu2+ e Hg2+, respectivamente. O volume mínimo de amostra necessário para esta análise é de 0,5 mL. Para analisar estes metais em amostras de águas coletadas do sistema Guarapiranga...

Avaliação da albuminúria e da eletroforese de proteínas urinárias de cães com hiperadrenocorticismo e a relação com a pressão arterial sistêmica; Evaluation of albuminuria and urinary protein electrophoresis in dogs with hyperadrenocorticism and the relationship with sistemic blood pressure

Cavalcante, Carolina Zaghi
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Dissertação de Mestrado Formato: application/pdf
Publicado em 19/12/2007 PT
Relevância na Pesquisa
O hiperadrenocorticismo é uma das endocrinopatias mais comuns em cães, sendo caracterizado pela exposição excessiva de glicocorticóides secretados pelas adrenais. A hipercortisolemia crônica pode promover várias complicações, incluindo hipertensão sistêmica e glomerulonefrite. A glomerulonefrite pode desencadear variáveis graus de proteinúria e uma tendência de evolução para doença renal crônica. A perda de proteínas na urina, principalmente da albumina, é uma característica das doenças glomerulares e a determinação de variáveis laboratoriais, como a razão proteína:creatinina urinária (RPC), albuminúria (teste de ELISA) e eletroforese das proteínas urinárias, são recomendadas para a elucidação do diagnóstico. Assim, o objetivo do estudo é avaliar a relação entre proteinúria e hipertensão arterial sistêmica em cães com hiperadrenocorticismo e verificar, pela avaliação da albuminúria e do peso molecular das proteínas urinárias, o segmento do néfron que foi comprometido ou lesado. Foram avaliados 30 cães com diagnóstico de hiperadrenocorticismo, subdivididos em 13 cães com hipertensão arterial sistêmica (grupo I) e 17 cães normotensos (grupo II). Foram determinados a razão proteína:creatinina urinária (RPC); a albuminúria pela avaliação da albumina normalizada e razão albumina: creatinina urinária (RAC) e a eletroforese de proteínas pela técnica em gel de poliacrilamida...

Eletroforese capilar como ferramenta analítica para toxicologia forense; Cappilary electrophoresis as analytical tool for forensic toxicology

Costa, José Luiz da
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Tese de Doutorado Formato: application/pdf
Publicado em 13/06/2008 PT
Relevância na Pesquisa
No primeiro capítulo deste trabalho, são apresentados aspectos gerais sobre toxicologia forense e sobre a eletroforese capilar, onde se buscou mostrar como a técnica analítica pode ser útil para aplicações forenses. O segundo capítulo apresenta o desenvolvimento de metodologia analítica baseada em eletroforese capilar com detecção por arranjo de diodos para determinação de drogas de abuso ou seus produtos de biotransformação em humor vítreo. Foram estudados parâmetros como a composição do eletrólito de corrida (com especial atenção ao fenômeno de eletrodispersão), pré-concentração online (stacking) e modo de extração dos analitos. Foi obtida completa separação eletroforética de 12 analitos investigados em menos de 10 minutos de corrida. Os parâmetros de confiança analítica do método mostraram este é perfeitamente aplicável às análises toxicológicas com finalidade forense. O terceiro capítulo apresenta a elaboração de metodologia analítica baseada em eletroforese capilar acoplada a espectrometria de massas para determinação de cocaína e cinco produtos de biotransformação em urina, com procedimento de preparo da amostra biológica simplificado. O procedimento desenvolvido apresentou sensibilidade adequada para verificação de intoxicações agudas por cocaína...

Estabilidade de espécies de arsênio em amostras biológicas acoplando cromatografia líquida ou eletroforese capilar com detectores atômicos; Stability of arsenic species in biological samples by coupling liquid chromatography or capillary electrophoresis with atomic detectors

Suarez, Carlos Alfredo
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Tese de Doutorado Formato: application/pdf
Publicado em 14/05/2010 PT
Relevância na Pesquisa
Neste projeto foram abordados procedimentos analíticos para extração, separação e identificação de espécies de arsênio encontradas normalmente em quantidades de traços e ultra-traços em amostras biológicas e ambientais. Entre as amostras alvo deste estudo, teve-se alimentos de origem marinha como por exemplo camarão. Foi avaliada a estabilidade das espécies de arsênio nas soluções geradas pelos processos de extração. Para separação das espécies inorgânicas (arsenito e arsenato), metiladas (ácidos mono e dimetil arsênio) e orgânicas (arsenobetaina) empregaram-se as técnicas eletroforese capilar (CE) e cromatografia líquida (LC). Os sistemas de separação para a determinação das espécies de arsênio foram acoplados com os espectrômetros massas (ICP-MS), e de fluorescência atômica (AFS). Os sistemas acoplados apresentaram resolução e sensibilidade na determinação das espécies de arsênio nas amostras estudadas neste trabalho. A extração com água de espécies de As utilizando-se banho de ultra-som apresentou eficiência acima de 78%. A estabilidade das espécies nas soluções padrão e nos extratos das amostras foi mantida por um período de até uma semana quando armazenadas em geladeira (+4°C). Visando uma política de química limpa...

Implementação e otimização de detector condutométrico sem contato para eletroforese capilar; Implementation and optimization of contactless conductometric detector for capillary electrophoresis

Francisco, Kelliton José Mendonça
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Dissertação de Mestrado Formato: application/pdf
Publicado em 14/12/2010 PT
Relevância na Pesquisa
A presente dissertação trata da implementação e otimização de um sistema de detecção condutométrica sem contato capacitivamente acoplada (C4D) para Eletroforese Capilar (CE). O sistema é caracterizado pela compactação do sistema de detecção, versatilidade e flexibilidade de instalação em diferentes equipamentos comerciais de eletroforese capilar e home made. Desde a década de 80, a eletroforese capilar vem se consolidando como uma das técnicas de separação mais relevantes. Normalmente, os instrumentos comerciais são disponibilizados com detectores ópticos e detectores eletroquímicos. A C4D é utilizada em eletroforese capilar posicionando-se dois eletrodos tubulares envoltos ao capilar. A aplicação de sinais de alta frequência entre os eletrodos permite monitorar variações de condutividade da solução dentro do capilar. Assim, a resposta do detector depende de diversos fatores como mobilidade do analito, do co-íon do eletrólito, da frequência e amplitude do sinal aplicado entre os eletrodos e da geometria dos mesmos. A ausência de componentes móveis torna o presente detector compacto (6,5 cm3) e robusto. O presente C4D é constituído de um oscilador local funcionando a 1,1 MHz, um circuito capaz de converter corrente em tensão...

A eletroforese capilar para a separação das metalotioneínas da cianobactéria (Synechococcus PCC 7942) e de mamíferos; Capillary electrophoresis for the separation of cyanobacterial metallothionein (Synechococcus PCC 7942) and mammals

Vida, Ana Clara Felix
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Dissertação de Mestrado Formato: application/pdf
Publicado em 23/03/2011 PT
Relevância na Pesquisa
Metalotioneínas (MTs) são proteínas de baixa massa molecular, que tem como principal função a regulação dos níveis de metais nos organismos. A caracterização das MTs da cianobactéria Synechococcus PCC 7942 por eletroforese capilar foi feita em comparação com os padrões comerciais de MTs de rim de cavalo e de fígado de coelho. As MTs de mamíferos apresentam diferentes arranjos moleculares, classificadas em isoformas. Na aplicação da eletroforese capilar como metodologia analítica para a otimização da separação das isoformas existentes, foram investigados a influência da composição da solução eletrolítica, variações da voltagem, comprimento do capilar e diâmetro interno do capilar. Os perfis eletroforéticos das misturas das MTs purificadas a partir de rim de cavalo e fígado de coelho comparados com a de cianobactéria mostraram uma diferenciação no tempo de migração. Para a separação foram testados eletrólitos tais como fosfato, borato e TRIS-HCl, sendo que os melhores resultados foram obtidos com o tampão TRIS-HCl (70 mM, pH 8,2) com adição de 5% de metanol. A separação eletroforética foi testada em capilares de sílica fundida de 75 e 25 m d.i., comprimento de 40, 50 e 60 cm. As soluções das amostras em volume de 327 nL foram introduzidas por injeção hidrodinâmica. As diferenças de potencial testadas foram de 10...

Investigação por eletroforese capilar com detecção condutométrica sem contato sobre a formação e as propriedades de monoalquil carbonatos em meio aquoso; Investigation by capillary electrophoresis with contactless conductivity detection on the formation and properties of monoalkyl carbonates in aqueous medium

Vidal, Denis Tadeu Rajh
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Tese de Doutorado Formato: application/pdf
Publicado em 24/11/2011 PT
Relevância na Pesquisa
A formação dos monoalquil carbonatos (MACs) em meio aquoso - produzidos pela reação de um álcool e bicarbonato foi investigada por eletroforese capilar (CE) com detecção condutométrica sem contato (C4D). Foram estudadas ao todo 29 substâncias, das quais 25 apresentaram formação de adutos aniônicos monocarregados e 2 delas, adutos aniônicos com dupla carga. A eletroforese capilar proporcionou a obtenção de medidas de propriedades físico-químicas. Através do tempo de migração, foram obtidos mobilidade, coeficiente de difusão e raio iônico hidratado. Para os n-álcoois de 1 a 5 átomos de carbono, os adutos apresentaram raio iônico hidratado entre 216 pm e 310 pm. Os MACs têm raio iônico proporcional ao do álcool gerador, sendo sistematicamente maiores devidos à anexação do grupo carbonato. Quando comparado a ácidos carboxílicos de cadeia carbônica similar, os MACs possuem menor raio iônico hidratado. A obtenção dos valores da cinética de formação e hidrólise foi possível pela utilização de dupla detecção condutométrica, a qual permitia determinar a concentração do MAC em dois momentos diferentes ao longo da coluna. Devido à impossibilidade de uma calibração direta - já que os sais de MACs se decompõem em água - foi introduzida uma nova técnica de calibração que dispensa o uso de uma solução padrão do analito em favor de uma com espécie de mobilidade similar. As constantes cinética e termodinâmica foram comparadas com aquelas disponíveis na literatura...

Separação de fármacos antimaláricos por eletroforese capilar; Separation of antimalarial drugs by capillary electrophoresis

Rodrigues, Karina Trevisan
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Dissertação de Mestrado Formato: application/pdf
Publicado em 24/08/2012 PT
Relevância na Pesquisa
A malária é a doença que mais mortes causa no mundo. O uso de fármacos antimaláricos representa a solução mais eficaz para o combate e controle da doença e o interesse pelo desenvolvimento de novos fármacos é grande devido a problemas de resistência. Existe uma grande variedade de fármacos antimaláricos, sendo que muitos deles são quirais, vendidos e administrados como mistura racêmica. Nas últimas décadas, houve um aumento no interesse quanto aos aspectos farmacodinâmicos e farmacocinéticos de fármacos quirais, devido ao conhecimento de que um dos isômeros pode ser mais ativo ou mais tóxico que o outro. Sendo assim, tem-se a necessidade do desenvolvimento de métodos analíticos enantiosseletivos, e a eletroforese capilar tem emergido como uma técnica de separação quiral com alto poder de resolução. Além disso, a inexistência de métodos oficiais para fármacos antimaláricos e os poucos estudos que relatam aplicações na análise de formulações farmacêuticas, demandam o desenvolvimento e validação de novos métodos para tal finalidade. Este trabalho tem como objetivo o desenvolvimento de dois métodos analíticos, não quiral e quiral, para a determinação de fármacos antimaláricos em formulações farmacêuticas por eletroforese capilar. O método não quiral utilizou eletroforese capilar de zona...

Derivatização eletroquímica da álcoois num sistema em fluxo para determinação quantitativa por eletroforese capilar com detecção condutométrica sem contato; Electrochemical derivatization of alcohols in a flow system for quantitative determinations by capillary electrophoresis and contactless conductivity detection

Santos, Mauro Sergio Ferreira
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Dissertação de Mestrado Formato: application/pdf
Publicado em 29/10/2012 PT
Relevância na Pesquisa
A eletroforese capilar (CE) é uma técnica poderosa de separação que explora as diferenças na mobilidade de espécies iônicas sob efeito do campo elétrico. Não permite, contudo, separação de misturas de moléculas neutras, possível mediante formação de complexos com carga, derivatização química ou cromatografia eletrocinética micelar (MEKC). A derivatização eletroquímica tem sido usada em combinação com HPLC, entre outras técnicas, mas não ainda com CE e para fins quantitativos, como proposto e demonstrado nesta dissertação, em que se enfoca, como sistemas modelo, álcoois primários de cadeia curta e se recorre a sistema em fluxo designado de EC-CE-C4D, que consiste de uma célula eletroquímica acoplada com equipamento de eletroforese capilar provido de detector de condutividade sem contato direto com os eletrodos. O sistema EC-CE-C4D, inicialmente concebido para efetuar pré-concentração e redissolução eletroquímica de metais seguida de separação eletroforética, possibilitou também o monitoramento de produtos com carga, formados em processos eletrocatalíticos, fato que inspirou a investigação da aplicabilidade, também do sistema à derivatização eletroquímica de analitos neutros em iônicos ou ionizáveis. Inicialmente...

Aplicações da eletroforese capilar na análise do biomarcadir alfa-1 glicoproteína ácida, no controle de qualidade do biofármaco interferon alfa 2a e na avaliação da estabilidade enantiosseletiva do fármaco isradipina; Applications of capillary electrophoresis in the analysis of biomarker alpha-1 acid glycoprotein, in the quality control of the biodrugs interferon alpha 2a, and enantioselective stability evaluation of drug isradipine

Aguiar, Fernando Armani
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Tese de Doutorado Formato: application/pdf
Publicado em 08/08/2013 PT
Relevância na Pesquisa
A eletroforese é uma técnica de separação que se baseia na migração diferencial de compostos iônicos em tubo capilar semicondutor, preenchido com solução eletrolítica, sob a influência de campo elétrico. Na introdução desta tese, princípios, métodos e diferentes tipos de técnicas de eletromigração em capilar foram discutidos. No primeiro capítulo são mostrados os resultados de otimização e validação de um método eletroforético para a determinação das glicoformas da ?1-Glicoproteína Ácida, um biomarcador. A otimização das condições eletroforéticas usando eletrólito de corrida constituído por tricina (10 mmol L-1), cloreto de sódio (10 mmol L-1), acetato de sódio (10 mmol L-1), ureia (7 mol L-1) e putrescina (3,9 mmol L-1), pH de 4,5, tensão de 30 kV, e temperatura de análise de 35 °C levou à resolução mínima de aproximadamente 1,5 entre as oito glicoformas encontradas. Todas as análises foram realizadas em um capilar de sílica fundida não revestido internamente, diâmetro interno de 50 µm e comprimento efetivo de 50,0 centímetros. Após a otimização, o método foi validado, em que a linearidade foi obtida no intervalo de 0,125 a 2,5 mg mL-1 (r >= 0,993). O coeficiente de variação (%) e erros relativos (%) obtidos nos estudos de precisão e exatidão...

Análise de aldeídos de baixa massa molar no ar utilizando eletroforese capilar; Analysis of low molecular-weight aldehydes in air using capillary electrophoresis

Pereira, Elisabete Alves
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Tese de Doutorado Formato: application/pdf
Publicado em 07/05/2002 PT
Relevância na Pesquisa
Depois dos hidrocarbonetos, os aldeídos de baixa massa molar são os mais abundantes dos gases orgânicos encontrados na atmosfera. Os aldeídos provêm de diversas fontes como as atividades industriais, incompleta combustão de combustível fóssil e biomassa e como resultado de reações fotoquímicas na atmosfera. Os aldeídos são potentes precursores de importantes oxidantes como o nitrato de peroxiacetila (PAN) e ozônio. Eles são reconhecidamente irritante dos olhos e trato respiratório, além de possuir características mutagênicas e carcinogênicas em animais. Considerando o impacto toxicológico e ambiental destes compostos, a prevenção e controle dos aldeídos requerem o uso de novas e versáteis metodologias analíticas. Neste sentido, a eletroforese capilar tem mostrado ser uma técnica alternativa para a análise de aldeídos em amostras ambientais. Este trabalho descreve diferentes metodologias desenvolvidas, em eletroforese capilar, para a separação e análise de aldeídos em amostras de ar (indoor, outdoor) e emissão veicular. As metodologias incluem a separação dos adutos aniônicos bissulfito-aldeído e das hidrazonas aniônicas formadas a partir da reação dos aldeídos com dansilhidrazina (DNSH) e ácido 4-hidrazino benzóico (HBA) por eletroforese capilar em solução livre (free solution capillary electrophoresis...

Efeito de surfatantes e modificações metodologicas na solubilização de membrana mitocondrial interna de ratos analisada por eletroforese nativa e bidimensional; Effect of surfactants and methodologic alterations in the rat inner mitochondrial membrane solubilization analysed by native and two dimensional electrophoresis

Elizabeth Sousa da Cunha
Fonte: Biblioteca Digital da Unicamp Publicador: Biblioteca Digital da Unicamp
Tipo: Dissertação de Mestrado Formato: application/pdf
Publicado em 27/06/2008 PT
Relevância na Pesquisa
A mitocôndria é uma organela vital, pois em células aeróbicas, ela é responsável pela produção da maior parte da energia química necessária para a célula. A síntese de ATP ocorre por fosforilação oxidativa na Fo,F1-ATPase, usando a energia gerada pela cadeia de transporte de elétr ons, uma série de enzimas presentes na membrana mitocondrial interna. A análise de proteínas de membrana pode ser feita pela técnica de eletroforese, tanto em condições nativas quanto desnaturantes. Neste trabalho analisamos a solubilização de proteínas da membrana interna de mitocôndria de músculo de rato, através do uso de surfatantes zwiteriônicos (ASB-14, ASB-16, CHAPS), não-iônicos (Digitonina, C12E8, Triton X- 100) e aniônico (Colato de sódio) na separação por eletroforese em gel nativo e bidimensional. Desenvolvemos um novo protocolo para preparo de eletroforese em gel nativo, mantendo o tampão de amostra descrito no procedimento de BN-PAGE e adaptando as demais etapas da técnica de acordo com o protocolo de Laemmli et al (1970). Os géis assim preparados em temperatura ambiente mostraram melhor resolução que os pelo método BN-PAGE, foram obtidos menor tempo de corrida (1- 2 horas), sem troca de tampões e com emprego de reagentes de menor custo. Quanto a eficiência dos diferentes surfatantes...

Eletroforese capilar aplicada ao estudo de adulterações em amostras de uísques

Heller, Melina
Fonte: Universidade Federal de Santa Catarina Publicador: Universidade Federal de Santa Catarina
Tipo: Dissertação de Mestrado Formato: xiii, 74 p.| il., grafs., tabs.
Relevância na Pesquisa
Dissertação (mestrado) - Universidade Federal de Santa Catarina, Centro de Ciências Físicas e Matemáticas, Programa de Pós-Graduação em Química, Florianópolis, 2010; Neste trabalho, foram desenvolvidas três metodologias analíticas utilizando eletroforese capilar com a finalidade de diferenciar uísques autênticos de amostras apreendidas por suspeita de falsificação, cedidas pela Polícia Técnico-Científica do Estado de São Paulo. O primeiro capítulo trata da determinação simultânea dos aldeídos fenólicos: vanilina, seringaldeído, coniferaldeído e sinapaldeído. Estratégias de pré-concentração "on-line" ("stacking") foram desenvolvidas para melhorar a detectabilidade do método para determinação destes compostos. Os valores de R² foram maiores que 0,99 para os métodos sem e com pré-concentração (respectivamente denominados, NSM e SWMR42). A razão sinal/ruído (S/N) de 3 e 10 foram consideradas para estimar o LD e o LQ. Estes valores foram 100 ?g L-1 e 330 ?g L-1; 22 ?g L-1 e 73 ?g L-1 para NSM e SWMR42, respectivamente. Das 30 amostras analisadas, 14 apresentaram os aldeídos fenólicos estudados abaixo do limite de detecção. O segundo capítulo se refere ao desenvolvimento de um método para determinação dos açúcares frutose...

Desenvolvimento de métodos para determinação de cátions inorgânicos em leites, nitrito e nitrato em alface e histamina em peixes utilizando eletroforese capilar

Manoel, Rafael Vanderson Gomes
Fonte: Florianópolis, SC Publicador: Florianópolis, SC
Tipo: Dissertação de Mestrado Formato: 88 p.| il., grafs., tabs.
Relevância na Pesquisa
Dissertação (mestrado) - Universidade Federal de Santa Catarina, Centro de Ciências Físicas e Matemáticas, Programa de Pós-Graduação em Química, Florianópolis, 2011; O primeiro capítulo pretende descrever a fundamentação teórica inerente a eletroforese capilar (CE) aplicada à análise de alimentos, de forma a facilitar o compreendimento do restante da dissertação. Procura-se também esclarecer algumas equações, que descrevem o fluxo eletrosmótico, definições de termos usuais como solução tampão e aditivos, além de termos de validação de métodos como linearidade, curva de calibração, limite de detecção, limite de quantificação e precisão. Há também uma descrição básica dos programas Peakmaster®, utilizado na otimização dos parâmetros necessários à obtenção de separações adequadas, e Statistica®, utilizado no tratamento estatístico dos dados obtidos nas diversas análises realizadas. Nele também se encontram conceitos básicos para alguns termos de validação de métodos, além dos tratamentos estatísticos utilizados. Já o capítulo 2 tem como objetivo desenvolver um método por eletroforese capilar (CE) para comparar quantidades de potássio, sódio, cálcio e magnésio entre leites de soja e de vaca...

Desenvolvimento de método rápido para análise simultânea de metil, etil, propil e butilparabeno em amostras cosméticas e farmacêuticas e estudos de interação com macromoléculas biológicas utilizando eletroforese capilar

Dolzan, Maressa Danielli
Fonte: Florianópolis Publicador: Florianópolis
Tipo: Dissertação de Mestrado Formato: 129 p.| il., grafs., tabs.
Relevância na Pesquisa
Dissertação (mestrado) - Universidade Federal de Santa Catarina, Centro de Ciências Físicas e Matemáticas. Programa de Pós-Graduação em Química; Os p-hidroxibenzoatos de alquila, ou parabenos, fazem parte de uma classe de compostos com atividade antimicrobiana mais utilizada em todo o mundo. Desde os anos 20 eles são adicionados às formulações. Entretanto, o avanço científico e tecnológico levantou a hipótese destes apresentarem atividade cancerígena, entre outros malefícios. Por isto este trabalho propõe tanto o controle da concentração destes compostos em produtos comerciais (capítulo 1), quanto um maior entendimento da sua ação biológica (capítulo 2). O primeiro capítulo aborda o desenvolvimento de um método simples e rápido por eletroforese capilar para análises de rotina de metil, etil, propil e butilparabeno em produtos comerciais, com preparo simples de amostra. O pH e os constituintes do eletrólito foram selecionados usando curvas de mobilidade efetiva versus pH e simulações com o software Peakmaster®. Ácido cinâmico foi usado como padrão interno. O eletrólito foi composto por 20 mmol L-1 de ácido 2-hidroxiisobutírico (HIBA), 30 mmol L-1 de trietilamina (TEA) e 0,3 mmol L-1 de brometo de hexano-1...

Aplicação da eletroforese capilar com detecção condutométrica sem contato no controle de qualidade de formulações farmacêuticas contendo aspirina ou dipirona em combinação com outros princípios ativos

Marra, Mariana Cardoso
Fonte: Universidade Federal de Uberlândia Publicador: Universidade Federal de Uberlândia
Tipo: Dissertação
Relevância na Pesquisa
Neste trabalho, a técnica de eletroforese capilar com detecção condutométrica sem contato (CE-C4D) foi utilizada no desenvolvimento de métodos rápidos de controle de qualidade de medicamentos. O tampão de corrida (BGE) composto por 20 mmol L-1 de 2-Amino-2-hidroximetil-propano-1,3diol (TRIS) e 10 mmol L-1 de ácido 3,4-dimetoxicinâmico (DMX), pH 8,4; foi usado na análise de duas formulações farmacêuticas contendo: (a) dipirona (DIP) + cafeína (CAF); (b) ácido acetilsalicílico (AAS) + CAF. Outro BGE, composto por 12 mmol L-1 de trietanolamina (TEA) e 10 mmol L-1 de DMX (pH 8,5) foi usado na análise de amostras farmacêuticas contendo: (a) DIP + escopolamina (ESC); (b) DIP + CAF + orfenadrina (ORF); (c) DIP + CAF + mepiramina (MEP) + ácido ascórbico (AA). Todos os métodos de análise propostos são rápidos, com tempo de duração igual ou inferior a 1 minuto. Adicionalmente, os produtos de degradação da DIP (metilamina) e AAS (ácido salicílico) também foram detectados. Eletroforese capilar acoplada à espectrometria de massas (CE-MS) foi utilizada para confirmar a formação da metilamina (composto detectado de forma inédita). Na determinação de CAF, DIP, AAS e AS, os DPR (n = 10) calculados foram inferiores a 6%...

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

Dias, Francisca Elda Ferreira; Nunes, Caris Maroni; Cavalcante, Tânia Vasconcelos; Castro, Andréa Azevedo Pires De; Ferreira, Jorge Luis; Garcia, José Fernando
Fonte: Universidade Federal de Goiás Publicador: Universidade Federal de Goiás
Tipo: Artigo de Revista Científica Formato: 366-372
Relevância na Pesquisa
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.; Este estudo avaliou o limiar de detecção da técnica de PCR aliada à eletroforese capilar para diagnóstico da Brucella abortus em sêmen bovino. Doses inseminantes livres de patógenos foram contaminadas experimentalmente com B. abortus em escalas que variavam de 10(0) a 10(7) bactérias/mL e submetidas à extração de DNA pelo método de fenol/clorofórmio. A amplificação por PCR foi realizada utilizando-se oligonucleotídeos iniciadores...

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

Dias,Francisca Elda Ferreira; Nunes,Cáris Marone; Cavalcante,Tânia Vasconcelos; Castro,Andréa Azevedo Pires de; Ferreira,Jorge Luis; Garcia,José Fernando
Fonte: Universidade Federal de Goiás Publicador: Universidade Federal de Goiás
Tipo: Artigo de Revista Científica Formato: text/html
Publicado em 01/09/2013 PT
Relevância na Pesquisa
Este estudo avaliou o limiar de detecção da técnica de PCR aliada à eletroforese capilar para diagnóstico da Brucella abortus em sêmen bovino. Doses inseminantes livres de patógenos foram contaminadas experimentalmente com B. abortus em escalas que variavam de 10(0) a 10(7) bactérias/mL e submetidas à extração de DNA pelo método de fenol/clorofórmio. A amplificação por PCR foi realizada utilizando-se oligonucleotídeos iniciadores, previamente descritos na literatura, BF-5'gcgctcaggctgccgacgcaa3' (cromóforo FAM) e BR-5'accagccattgcggtcggta3' para B. abortus.) Os pares de oligonucleotídeos geraram fragmentos de 193 pb. Após PCR, a visualização dos fragmentos foi realizada em gel de acrilamida 8% corada pela prata e por eletroforese capilar fluorescente em equipamento automático de análise de fragmentos de DNA. A detecção de DNA de B. abortus em sêmen bovino através de eletroforese capilar fluorescente foi possível a partir de concentração de 10³ bactérias/mL, enquanto que em gel de poliacrilamida 8% o limite de detecção foi de 10(5) bactérias/mL. A eletroforese capilar demonstrou ser uma alternativa rápida, eficaz e de alta sensibilidade na detecção de DNA de Brucella em sêmen bovino, podendo ser uma valiosa ferramenta para a avaliação da sanidade do rebanho e para o controle de qualidade do sêmen produzido em centrais de inseminação artificial.

Detecção de Leptospira pomona em sêmen bovino por eletroforese capilar fluorescente; Detection of Leptospira pomona in bovine semen by fluorescent capillary eletrophoresis

Dias, Francisca Elda Ferreira; Aoki, Sérgio Morais; Mesquita, Lígia Garcia; Nunes, Caris Maroni; Garcia, José Fernando
Fonte: Universidade de São Paulo. Faculdade de Medicina Veterinária e Zootecnia Publicador: Universidade de São Paulo. Faculdade de Medicina Veterinária e Zootecnia
Tipo: info:eu-repo/semantics/article; info:eu-repo/semantics/publishedVersion; ; ; ; ; ; Formato: application/pdf
Publicado em 01/01/2006 POR
Relevância na Pesquisa
Este estudo pretendeu avaliar o limiar de detecção da técnica de PCR aliada à eletroforese capilar para diagnóstico da Leptospira pomona em sêmen bovino. Doses inseminantes livres de patógenos foram contaminadas experimentalmente com Leptospira pomona em escalas que variavam de 10(0) a 10(7) bactérias/ml e submetidas à extração de DNA pelo método de fenol/clorofórmio. Após a reação de PCR, a visualização dos fragmentos foi realizada em três tipos de eletroforese: agarose 2% sob luz UV, acrilamida 8% corado com prata e eletroforese capilar fluorescente. A detecção de DNA de Leptospira pomona em sêmen bovino através de eletroforese capilar fluorescente foi possível a partir de concentração de 10² bactérias/ml. Nos métodos de eletroforese em agarose 2%, observou-se limite de detecção de 10(4) bactérias/ml e em gel de poliacrilamida 8% o limite de detecção foi de 10² bactérias/ml. A eletroforese capilar demonstrou ser uma alternativa eficaz e rápida na detecção de DNA de Leptospira em sêmen bovino podendo ser uma valiosa ferramenta para controle de qualidade do sêmen produzido em centrais de inseminação artificial dada a facilidade de automação desse processo.; This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Leptospira pomona diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with Leptospira pomona (10(0) to 10(7) bacteria/ml) and DNA was extracted by phenol/chloroform protocol. DNA fragments visualization was done by three electrophoresis methods: under UV light in 2% agarose gel...