Página 1 dos resultados de 64 itens digitais encontrados em 0.003 segundos

Cloning and overexpression of the xylose isomerase gene from Burkholderia sacchari and production of polyhydroxybutyrate from xylose

LOPES, Mateus Schreiner Garcez; GOMEZ, Jose Gregorio Cabrera; SILVA, Luiziana Ferreira
Fonte: NATL RESEARCH COUNCIL CANADA-N R C RESEARCH PRESS Publicador: NATL RESEARCH COUNCIL CANADA-N R C RESEARCH PRESS
Tipo: Artigo de Revista Científica
ENG
Relevância na Pesquisa
26.07%
A different organization for the xyl operon was found in different genomes of Burkholderia and Pseudomomas species. Degenerated primers were designed based on Burkholderia genomes and used to amplify the xylose isomerase gene (xylA) from Burkholderia sacchari IPT101 The gene encoded a protein of 329 amino acids, which showed the highest similarity (90%) to the homologous gene of Burkholderia dolosa. It was cloned in the broad host range plasmid pBBR1MCS-2, which partially restored growth and polyhydroxybutyrate production capability in xylose to a B. sacchari xyl(-) mutant. When xylA was overexpressed in the wild-type strain, it was not able to increase growth and polyhydroxybutyrate production, suggesting that XylA activity is not limiting for xylose utilization in B. sacchari.; Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP); Amparo a Pesquisa do Estado de Sao Paulo (FAPESP)[04/15369-0]

Gene da putativa indolpiruvato descarboxilase de Phytomonas: caracterização, arranjo genômico, marcador molecular e origem filogenética.; Gene of the putative indolepyruvate decarboxylase of Phytomonas: characterization, genomic arrangement, molecular marker and phylogenetic origin.

Silva, Susan Ienne da
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Dissertação de Mestrado Formato: application/pdf
Publicado em 09/01/2008 PT
Relevância na Pesquisa
26.07%
O gênero Phytomonas está associado a enfermidades devastadoras em plantações de interesse econômico, enquanto que outros vegetais parasitados não apresentam nenhum dano aparente. A seqüência-consenso de um agrupamento de ESTs de P. serpens determinado anteriormente apresentou alta similaridade com indolpiruvato descarboxilases (IPDCs) de fitobactérias e putativas piruvato/indolpiruvato descarboxilases de Leishmania spp. A enzima IPDC está na via de biossíntese do ácido 3-indolil acético, um dos hormônios vegetais mais importantes. Verificamos que o gene IPDC está presente em diversos isolados de Phytomonas, em múltiplas cópias (cerca de 104 cópias em P. serpens e 200 cópias em P. françai), contíguas e concentradas em uma banda cromossômica. Análises filogenéticas e amplificações por PCR com oligonucleotídeos degenerados apontam o clado Phytomonas-Leishmania como grupo-irmão de IPDCs de fitobactérias, sugerindo um processo de transferência horizontal anterior à separação dos tripanossomatídeos do clado que também inclui Leptomonas, Herpetomonas e Crithidia.; The genus Phytomonas is associated to devastating diseases in commercially important crops, whereas in other plant species no apparent damage is observed. The consensus sequence of one group of ESTs of P. serpens previously determined showed high similarity with indolepyruvate decarboxylases (IPDCs) from phytobacteria and putative pyruvate/indolepyruvate decarboxylases of Leishmania spp. The enzyme ipdC participates in the biosynthetic pathway of the indole-3-acetic acid...

Caracterização molecular de cianobactérias isoladas de ecossistema manguezal do Estado de São Paulo e identificação de produtos naturais; Molecular characterization of cyanobacteria isolated from mangrove ecosystem of the State of São Paulo and identification of natural products

Silva, Caroline Souza Pamplona da
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Tese de Doutorado Formato: application/pdf
Publicado em 28/06/2010 PT
Relevância na Pesquisa
26.07%
O gene de RNAr 16S tem sido amplamente utilizado na inferência filogenética de organismos procariotos, entretanto, sequências desse gene de cianobactérias isoladas de manguezais brasileiros são inexistentes. Neste estudo, 42 sequências inéditas do gene de RNAr 16S de cianobactérias isoladas de manguezais brasileiros foram geradas. Na análise BLAST as sequências apresentaram similaridades variando de 91 a 99% com outras sequências conhecidas de cianobactérias depositadas no GenBank. Na análise filogenética do gene de RNAr 16S várias sequências do gênero Chlorogloea ficaram agrupadas com sequências do gênero Synechococcus e algumas sequências de Nostoc ficaram mais próximas de sequências de Nodularia. As sequências de Leptolyngbya agruparam-se separadas das típicas de Leptolyngbya. Esses resultados corroboram com outros estudos, os quais mostraram que o filo Cyanobacteria necessita de revisão taxonômica. Na avaliação do potencial de produção de substâncias bioativas de 44 isolados de manguezais utilizando a técnica de PCR e dois conjuntos de oligonucleotídeos iniciadores degenerados específicos para sequências gênicas codificantes de peptídeo sintetase não ribossômica (NRPS) e policetídeo sintase (PKS) modular...

Isolamento e caracterização de clones da família de glicoproteínas (Tc-85) de Trypanosoma cruzi; Isolation and characterization of clones family of glycoproteins (Tc-85) of Trypanosoma cruzi

Oliveira, Débora Rose de
Fonte: Biblioteca Digitais de Teses e Dissertações da USP Publicador: Biblioteca Digitais de Teses e Dissertações da USP
Tipo: Dissertação de Mestrado Formato: application/pdf
Publicado em 23/11/2000 PT
Relevância na Pesquisa
26.4%
Vários laboratórios descreveram moléculas que estão envolvidas na invasão do Trypanosoma cruzi à célula hospedeira. Nosso laboratório foi o primeiro a descrever moléculas de 85 kDa pertencentes a uma família de glicoproteínas (Tc-85) que possuem graus diferentes de homologia de seqüência com os membros da superfamília das gp85/transialidases. Um componente acídico (Tc85-11) da família Tc-85 que se liga à laminina e a receptores da célula hospedeira foi clonado e expresso (Giordano et al., JBC 274, 3461,1999). Nós levantamos a hipótese de que o polimorfismo dos diferentes membros da família Tc-85 poderiam determinar diferentes propriedades da adesão à célula hospedeira. Para provar tal hipótese, uma biblioteca genômica de Tc-85 utilizando o vetor pTEX e os seguintes primers: R-1 (5') ATGTCCCGGCGTGTGTTTACTTCC e GPI-2(3') TCACAAAGTCGCAAAGCCCCACAGTCC, foi digerida com enzimas de restrição resultando em fragmentos de tamanho esperado (~2-2,5 kb) em 91% dos clones selecionados. Treze clones foram seqüenciados em suas extremidades 5' e 3'. Nenhum era idêntico entre si apesar da variabilidade da homologia de seqüência (40-70%). No entanto, quando comparadas as regiões codantes para o peptídeo sinal foi encontrada uma homologia de 90%. Para assegurar a clonagem de genes funcionais...

Detecção da infecção pelo vírus da artrite-encefalite caprina: imunodifusão em ágar e reação em cadeia da polimerase com "primers" degenerados; Detection of caprine arthritis-encephalitis virus infection : agar gel immunodiffusion and polymerase chain reaction with degenerated primers

Rutkoski, Juliana Klein; Werenicz, R.; Reischak, D.; Wendelstein, Ana Cristina da Silva; Moojen, Valeria; Ravazzolo, Ana Paula
Fonte: Universidade Federal do Rio Grande do Sul Publicador: Universidade Federal do Rio Grande do Sul
Tipo: Artigo de Revista Científica Formato: application/pdf
POR
Relevância na Pesquisa
66.79%
O objetivo deste trabalho foi analisar amostras de soro e de células sangüíneas de caprinos para detecção de anticorpos e DNA proviral do vírus da artrite-encefalite caprina (CAEV), respectivamente. Utilizou-se a técnica de imunodifusão em ágar (AGID) e a reação em cadeia da polimerase (PCR) com “primers” degenerados. Foram analisadas amostras de diferentes procedências: 39 de Mato Grosso do Sul (MS), 19 de São Paulo (SP) e 22 do Ceará (CE), dessas últimas, 12 oriundas de animais importados do Canadá. Os resultados de AGID e PCR foram discordantes, pois o primeiro permitiu a detecção de 25 animais soropositivos, enquanto a PCR detectou DNA proviral de CAEV em 16 amostras. Pela PCR foi possível identificar animais infectados cujos testes sorológicos foram negativos pelo AGID: oito amostras do MS e um do CE. São discutidos diferentes aspectos que poderiam estar envolvidos na discordância dos resultados.; The purpose of this work was to analyse serum and blood cells from caprine origin to detect antibody and proviral DNA of caprine arthritis encephalitis virus (CAEV), respectively. Agar gel immunodiffusion (AGID) and polymerase chain reaction (PCR) with degenerated primers were used. Samples of different geographical regions were analysed: 39 from Mato Grosso do Sul (MS)...

Clonagem de oxidoesqualeno ciclases de Maytenus ilicifolia Mart. ex Reissek (CELASTRACEAE)

Alves, Thaís Barboni
Fonte: Universidade Estadual Paulista (UNESP) Publicador: Universidade Estadual Paulista (UNESP)
Tipo: Dissertação de Mestrado Formato: 83 f. : il. -
POR
Relevância na Pesquisa
26.34%
Pós-graduação em Biotecnologia - IQ; A classe dos triterpenos pentacíclicos apresenta uma diversidade de estruturas que é devida ao número de rearranjos que a molécula do precursor oxidoesqualeno sofre durante a ciclização, sendo a friedelina o derivado com maior número de rearranjos. As oxidoesqualeno ciclases (OSCs) são enzimas que catalizam a biossíntese dos triterpenos, gerando essa variedade de estruturas. O objetivo deste estudo foi clonar OSCs a partir de folhas de Maytenus ilicifolia Mart. ex Reissek, uma espécie medicinal brasileira, para posterior análise funcional dos seus triterpenos pentacíclicos e localização filogenética em relação às OSC já caracterizadas de outras espécies. Para esta finalidade, adotou-se a estratégia de RT-PCR. O RNA total foi extraído a partir das folhas de M. ilicifolia e utilizado na síntese de cDNA. A amplificação de fragmentos “core” de genes de OSCs foi realizada com iniciadores parcialmente degenerados desenhados para amplificar regiões conservadas entre enzimas dessa família. Os fragmentos clonados foram sequenciados e iniciadores específicos foram desenhados para as amplificações das extremidades 5’ e 3’. Posteriormente iniciadores específicos foram desenhados para clonagem dos cDNAs completos. Comparação com banco de dados revelou que uma das ORFs obtida possui alta identidade com cicloartenol sintases de outras espécies de plantas já caracterizadas e que outras três ORFs clonadas possuem alta identidade com triterpeno sintases como beta-amirina...

Caracterização parcial e desenvolvimento de oligonucleotídeos específicos para detecção de sequivírus infectando alface

Jadão, Adriana Salomão
Fonte: Universidade Estadual Paulista (UNESP) Publicador: Universidade Estadual Paulista (UNESP)
Tipo: Tese de Doutorado Formato: x, 126 f. il., color, grafs .
POR
Relevância na Pesquisa
26.4%
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq); Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES); Pós-graduação em Agronomia (Proteção de Plantas) - FCA; A família Sequiviridae é constituída por dois gêneros: Waikavirus e Sequivirus. Os vírus apresentam partículas isométricas com aproximadamente 30nm de diâmetro e uma única fita de RNA sentido positivo, sendo que o genoma dos waikavírus é poliadenilado e dos sequivírus não. Dandelion yellow mosaic virus (DaYMV) foi relatado infectando alface em diferentes países da Europa e classificado no gênero Sequivirus, porém dados moleculares não estão disponíveis para este vírus. No Brasil, um vírus isométrico infectando alface foi isolado por Marinho et al., (1982) no Distrito Federal e denominado de Lettuce mottle virus (LeMoV). Um provável isolado deste vírus isométrico foi descrito mais tarde no estado de São Paulo por Stangarlin (1995), sendo encontrado frequentemente em infecções mistas com o Lettuce mosaic virus (LMV). Em ensaios de microscopia eletrônica utilizando antissoro policlonal específico para Dandelion yellow mosaic sequivirus (DaYMV) e extrato foliar de plantas infectadas pelo LeMoV, foi verificada uma reação sorológica parcial (Chaves...

Tobamovírus em Capsicum spp. no Estado de São Paulo: ocorrência, análise da variabilidade e avaliação de resistência

Cezar, Márcia Aparecida
Fonte: Universidade Estadual Paulista (UNESP) Publicador: Universidade Estadual Paulista (UNESP)
Tipo: Tese de Doutorado Formato: viii, 73 f. : il. color.,tabs.
POR
Relevância na Pesquisa
26.34%
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES); Pós-graduação em Agronomia (Proteção de Plantas) - FCA; Amostras de plantas sintomáticas provenientes de produções comerciais de pimentão e pimenta das regiões de Lins, Salto, Sorocaba, Itapetininga, Joanópolis no Estado de São Paulo foram obtidos durante os anos de 2000 a 2005 e analisadas quanto à espécie de tobamovírus presente. Visando ampliar o conhecimento da variabilidade biológica, bem como genética destes isolados, após a purificação por monolesões, estes isolados foram inoculados na série diferenciadora de Capsicum spp. contendo os genes L1, L2, L3 e L4 que permitiram a separação dos mesmos em patótipos. Foram observadas as espécies Tobacco mosaic virus (TMV), Tomato mosaic virus (ToMV) pertencentes ao patótipo P0 e Pepper mild mottle virus (PMMoV) pertencente ao patótipo P1-2, respectivamente. A maioria dos isolados de tobamovírus foram encontrados sob cultivo de estufa e com predominância do ToMV, porém com baixa incidência. A identidade das espécies de tobamovírus nas amostras de pimentão e pimenta foi confirmada por RT-PCR, utilizando-se oligonucleotídeos universais para o gênero Tobamovirus seguido de sequenciamento e específicos para cada uma das espécies. O sequenciamento do fragmento amplificado correspondente à parte da porção codificadora para a capa protéica dos isolados identificados como ToMV revelou identidade de aminoácidos entre 90% a 100% quando comparados com outras seqüências de To MV. Três isolados de ToMV não detectados pelos oligonucleotídeos específicos tiveram sua identidade confirmada após sequenciamento como pertencentes a esta espécie. Os isolados caracterizados como patótipo P1-2 de PMMoV apresentaram identidade de aminoácidos entre 96% a 100% quando comparados com outras seqüências de PMMoV. Nas principais regiões produtoras do Estado de São Paulo ainda não ocorre o patótipo P1-2-3 de PMMoV...

Produção, purificação e caracterização de xilanase termoestável produzida por Cryptococcus flavescens e expressão em Pichia pastoris; Production, purification and characterization of thermostable xylanase produced by Cryptococcus flavescens and expression in Pichia pastoris

Cristiane Conte Paim de Andrade
Fonte: Biblioteca Digital da Unicamp Publicador: Biblioteca Digital da Unicamp
Tipo: Tese de Doutorado Formato: application/pdf
Publicado em 23/05/2014 PT
Relevância na Pesquisa
26.25%
Xilanases são enzimas que hidrolisam as ligações glicosídicas entre as unidades de xilose que compõem a xilana, o principal constituinte hemicelulósico. Devido à grande disponibilidade desse tipo de material na natureza, as xilanases podem ser empregadas em diversos ramos, como nas indústrias têxtil, de alimentos e de rações, na bioconversão de resíduos lignocelulósicos, no clareamento de papel e polpa, e no tratamento de resíduos. Visando descrever novas enzimas para futuras aplicações, este trabalho teve como objetivo purificar e caracterizar a xilanase produzida pelo basidiomiceto Cryptococcus sp. LEB-AY10, uma levedura previamente isolada da Mata Atlântica e selecionada pela produção de enzima termoestável. Para tanto, o micro-organismo foi inicialmente identificado em nível de espécie e depositado como C. flavescens LEB-AY10 (CCT 7725); em sequência, foi estudada a produção da enzima utilizando, como substrato, bagaço de cana-de-açúcar, pré-tratado por explosão a vapor em três diferentes condições, bem como suas respectivas frações solúveis, e suplementados com melaço ou componentes sintéticos. Tendo sido definida a metodologia de tratamento do bagaço, técnicas de planejamento experimental foram utilizadas para estudar a influência das variáveis de cultivo e aumentar a atividade da xilanase produzida. Nas condições otimizadas...

HydHf, a hydrophobin gene from the saprophytic fungus Hypholoma fasciculare

Batista, Daniela; Baptista, Paula; Tavares, R. M.; Neto, T. Lino
Fonte: Universidade do Minho Publicador: Universidade do Minho
Tipo: Conferência ou Objeto de Conferência
Publicado em /05/2011 ENG
Relevância na Pesquisa
26.07%
European chestnut tree (Castanea sativa Mill.) is an economical important culture due to the production of high quality wood and fruit. Portugal is the second largest producer of chestnuts, for which the Northern region contributes for more than 85% of Portuguese production. A saprotrophic fungus was recently isolated from Trás-os-Montes chestnut orchards that interferes with chestnut root mycorrhization and displays strong antagonist activity against soil-borne fungi from orchard. To understand the high ability of this fungus to interact with chestnut tree root system, the involvement of specific proteins in in the adhesion of H. fasciculare will be studied. Hydrophobins are small hydrophobic proteins, which confer hydrophobicity to fungal surfaces in contact with air and mediate attachment of hyphae to hydrophobic surfaces, such as the root host surface. Predicting a potential role of hydrophobins on high adhesion capacity of H. fasciculare to C. sativa roots, degenerated primers were designed for amplification of hydrophobin genes in H. fasciculare genome. A genomic fragment of 176 pb was obtained, sequenced and used for obtaining the complete sequence of the corresponding transcript. The properties of the predicted protein will be presented...

Pesquisa e análise filogenética do gene da integrase de fagos de Helicobacter pylori

Timóteo, Andreia Durão, 1986-
Fonte: Universidade de Lisboa Publicador: Universidade de Lisboa
Tipo: Dissertação de Mestrado
Publicado em //2013 POR
Relevância na Pesquisa
26.07%
Tese de mestrado. Biologia (Biologia Molecular e Genética). Universidade de Lisboa, Faculdade de Ciências, 2013; A bactéria Helicobacter pylori infecta o estômago de aproximadamente metade da população humana estando associada ao desenvolvimento de patologias como gastrite, úlcera péptica e adenocarcinoma gástrico. Como principal terapêutica são utilizados dois antibióticos e um inibidor da bomba de protões. No entanto, a terapêutica com antibióticos é ineficaz em aproximadamente 20 a 30% dos pacientes, devido principalmente à resistência aos antibióticos, tornando necessário o desenvolvimento de novas terapêuticas. A terapêutica fágica consiste na utilização de bacteriófagos ou proteínas fágicas líticas para provocar a lise celular, sendo um processo alternativo a fim de evitar a resistência aos antibióticos. Para explorar a terapia fágica contra H. pylori é essencial a identificação e caracterização dos (pro)fagos desta espécie. Assim, este estudo tem como objectivos a pesquisa por PCR do gene da integrase de fagos de H. pylori de forma a compreender a prevalência de profagos nesta espécie e determinar a distribuição geográfica e/ou a patologia associada a estirpes integrase positivas. Em estirpes positivas para o gene que codifica a integrase foram pesquisados outros genes profágicos...

Cloning and Molecular Characterization of the Schistosoma mansoni Genes RbAp48 and Histone H4

Souza,Patrícia P; Santos,Débora N; Pena,Sérgio D J; Franco,Glória R
Fonte: Instituto Oswaldo Cruz, Ministério da Saúde Publicador: Instituto Oswaldo Cruz, Ministério da Saúde
Tipo: Artigo de Revista Científica Formato: text/html
Publicado em 01/10/2002 EN
Relevância na Pesquisa
26.07%
The human nuclear protein RbAp48 is a member of the tryptophan/aspartate (WD) repeat family, which binds to the retinoblastoma (Rb) protein. It also corresponds to the smallest subunit of the chromatin assembly factor and is able to bind to the helix 1 of histone H4, taking it to the DNA in replication. A cDNA homologous to the human gene RbAp48 was isolated from a Schistosoma mansoni adult worm library and named SmRbAp48. The full length sequence of SmRbAp48 cDNA is 1036 bp long, encoding a protein of 308 amino acids. The transcript of SmRbAp48 was detected in egg, cercariae and schistosomulum stages. The protein shows 84% similarity with the human RbAp48, possessing four WD repeats on its C-terminus. A hypothetical tridimensional structure for the SmRbAp48 C-terminal domain was constructed by computational molecular modeling using the b-subunit of the G protein as a model. To further verify a possible interaction between SmRbAp48 and S. mansoni histone H4, the histone H4 gene was amplified from adult worm genomic DNA using degenerated primers. The gene fragment of SmH4 is 294 bp long, encoding a protein of 98 amino acids which is 100% identical to histone H4 from Drosophila melanogaster.

Isolation of segments of homologous genes with only one conserved amino acid region via PCR

Laging, Martin; Fartmann, Berthold; Kramer, Wilfried
Fonte: Oxford University Press Publicador: Oxford University Press
Tipo: Artigo de Revista Científica
Publicado em 15/01/2001 EN
Relevância na Pesquisa
26.69%
We present a method which allows the isolation of fragments from genes coding for homologous proteins via PCR when only one block of conserved amino acids is available. Sets of degenerated primers are defined by reverse translation of the conserved amino acids such that each set contains not more than 128 different sequences. The second primer binding site is provided by a special cassette that is designed such that it does not allow binding of the second primer prior to being copied by DNA synthesis. The cassette is ligated to partially-digested chromosomal DNA. The second primer is biotinylated to allow elimination of PCR products carrying degenerated primers on both sides via streptavidin binding. Fragments obtained after amplification and enrichment are cloned and sequenced. The feasibility of this method was demonstrated in a model experiment, where degenerated primers were deduced from six conserved amino acids within the family of homologs to the Escherichia coli Vsr protein.

Transplacental transmission of Human Papillomavirus

Rombaldi, Renato L; Serafini, Eduardo P; Mandelli, Jovana; Zimmermann, Edineia; Losquiavo, Kamille P
Fonte: BioMed Central Publicador: BioMed Central
Tipo: Artigo de Revista Científica
Publicado em 25/09/2008 EN
Relevância na Pesquisa
26.25%
This paper aimed at studying the transplacental transmission of HPV and looking at the epidemiological factors involved in maternal viral infection. The following sampling methods were used: (1) in the pregnant woman, (a) genital; (b) peripheral blood; (2) in the newborn, (a) oral cavity, axillary and inguinal regions; (b) nasopharyngeal aspirate, and (c) cord blood; (3) in the placenta. The HPV DNA was identified using two methods: multiplex PCR of human β-globin and of HPV using the PGMY09 and PGMY11 primers; and nested-PCR, which combines degenerated primers of the E6/E7 regions of the HPV virus, that allowed the identification of genotypes 6/11, 16, 18, 31, 33, 42, 52 and 58. Transplacental transmission was considered when type-specific HPV concordance was found between the mother, the placenta and the newborn or the mother and cord blood. The study included 49 HPV DNA-positive pregnant women at delivery. Twelve placentas (24.5%, n = 12/49) had a positive result for HPV DNA. Eleven newborn were HPV DNA positive in samples from the nasopharyngeal or buccal and body or cord blood. In 5 cases (10.2%, n = 5/49) there was HPV type-specific agreement between genital/placenta/newborn samples. In one case (2%, n = 1/49) there was type specific HPV concordance between genital/cord blood and also suggested transplacental transmission. A positive and significant correlation was observed between transplacental transmission of HPV infection and the maternal variables of immunodepression history (HIV...

Restriction Site-dependent PCR: An Efficient Technique for Fast Cloning of New Genes of Microorganisms

Jiang, Yu; Pei, Jianjun; Song, Xin; Shao, Weilan
Fonte: Oxford University Press Publicador: Oxford University Press
Tipo: Artigo de Revista Científica
EN
Relevância na Pesquisa
26.57%
New bioactive proteins need to be screened from various microorganisms for the increasing need for industrial and pharmaceutical peptide, proteins, or enzymes. A novel polymerase chain reaction (PCR) method, restriction site-dependent PCR (RSD-PCR), was designed for rapid new genes cloning from genomic DNA. RSD-PCR strategy is based on these principles: (i) restriction sites disperse throughout genomes are candidacy for universal pairing; (ii) a universal primer is a combination of a 3′-end of selected restriction sites, and a 5′-end of degenerated sequence. A two-round PCR protocol was designed and optimized for the RSD-PCR: amplify the single strand target template from genomic DNA by a specific primer and amplify the target gene by using the specific primer and one of the universal RSD-primers. The optimized RSD-PCR was successfully applied in chromosome walking using specific internal primers, and cloning of new genes using degenerated primers derived from NH2-terminal amino acid sequence of protein.

Family-Specific Degenerate Primer Design: A Tool to Design Consensus Degenerated Oligonucleotides

Iserte, Javier Alonso; Stephan, Betina Ines; Goñi, Sandra Elizabeth; Borio, Cristina Silvia; Ghiringhelli, Pablo Daniel; Lozano, Mario Enrique
Fonte: Hindawi Publishing Corporation Publicador: Hindawi Publishing Corporation
Tipo: Artigo de Revista Científica
EN
Relevância na Pesquisa
26.44%
Designing degenerate PCR primers for templates of unknown nucleotide sequence may be a very difficult task. In this paper, we present a new method to design degenerate primers, implemented in family-specific degenerate primer design (FAS-DPD) computer software, for which the starting point is a multiple alignment of related amino acids or nucleotide sequences. To assess their efficiency, four different genome collections were used, covering a wide range of genomic lengths: Arenavirus (10 × 104 nucleotides), Baculovirus (0.9 × 105 to 1.8 × 105 bp), Lactobacillus sp. (1 × 106 to 2 × 106 bp), and Pseudomonas sp. (4 × 106 to 7 × 106 bp). In each case, FAS-DPD designed primers were tested computationally to measure specificity. Designed primers for Arenavirus and Baculovirus were tested experimentally. The method presented here is useful for designing degenerate primers on collections of related protein sequences, allowing detection of new family members.

Direct RNA-Based Detection and Differentiation of CTX-M-Type Extended-Spectrum β-Lactamases (ESBL)

Stein, Claudia; Makarewicz, Oliwia; Pfeifer, Yvonne; Brandt, Christian; Ramos, João Costa; Klinger, Mareike; Pletz, Mathias W.
Fonte: Public Library of Science Publicador: Public Library of Science
Tipo: Artigo de Revista Científica
Publicado em 05/11/2013 EN
Relevância na Pesquisa
26.48%
The current global spread of multi-resistant Gram-negatives, particularly extended spectrum β-lactamases expressing bacteria, increases the likelihood of inappropriate empiric treatment of critically ill patients with subsequently increased mortality. From a clinical perspective, fast detection of resistant pathogens would allow a pre-emptive correction of an initially inappropriate treatment. Here we present diagnostic amplification-sequencing approach as proof of principal based on the fast molecular detection and correct discrimination of CTX-M-β-lactamases, the most frequent ESBL family. The workflow consists of the isolation of total mRNA and CTX-M-specific reverse transcription (RT), amplification and pyrosequencing. Due to the high variability of the CTX-M-β-lactamase-genes, degenerated primers for RT, qRT as well as for pyrosequencing, were used and the suitability and discriminatory performance of two conserved positions within the CTX-M genes were analyzed, using one protocol for all isolates and positions, respectively. Using this approach, no information regarding the expected CTX-M variant is needed since all sequences are covered by these degenerated primers. The presented workflow can be conducted within eight hours and has the potential to be expanded to other β-lactamase families.

Molecular detection of bacteria in plant tissues, using universal 16S ribosomal DNA degenerated primers

Tsoktouridis, Georgios; Tsiamis, George; Koutinas, Nikolaos; Mantell, Sinclair
Fonte: Taylor & Francis Publicador: Taylor & Francis
Tipo: Artigo de Revista Científica
EN
Relevância na Pesquisa
46.69%
Highly specific, sensitive and rapid tests are required for the detection and identification of covert bacterial contaminations in plant tissue cultures. Current methods available for this purpose are tedious, time consuming, highly error prone, expensive, require advanced technical expertise and are sometimes ineffective. We report here the development of a sensitive polymerase chain reaction (PCR) based method for the rapid detection and identification of bacteria occurring in plant tissue cultures. A total of 121 16S ribosomal DNA (rDNA) coding regions from 14 different groups of bacteria, algae and plants, available in the Gene Bank/European Molecular Biology Laboratory databases, were aligned and several conserved DNA sequences of bacterial origin were identified. From those, five degenerated primers were designed in order to amplify only the bacterial DNA present in mixed plant/bacteria genomic DNA extracts. A known amount of bacterial suspension of either covert Pseudomonas or covert Bacillus were added to in vitro plant leaves and total plant/bacterial DNA extracted using three different methods to determine the lowest number of bacteria required to be present in order to allow their detection. The highest sensitivity of the bacterial cell detection was 2.5 × 106 cells of both Bacillus and Pseudomonas inoculums...

Detección molecular y tipificación del virus dengue por RT-PCR y PCR anidada usando oligonucleótidos mejorados

José A Usme-Ciro; Alba M Gómez-Castañeda; Juan C Gallego-Gómez
Fonte: Universidad del Norte Publicador: Universidad del Norte
Tipo: article; publishedVersion Formato: application/pdf
SPA
Relevância na Pesquisa
26.69%
ResumenObjetivo: Modificar los oligonucleótidos comúnmente utilizados para la detección y ti- pificación del virus dengue y evaluar su desempeño sobre ARNs provenientes de muestras clínicas. Materiales y métodos: A partir del alineamiento de secuencias disponibles en el Gen- Bank para la región C-prM/M se determinó la variabilidad genética dentro de cada serotipo del virus dengue, lo cual permitió realizar modificaciones a los oligonucleótidos conven- cionalmente usados en la tipificación. Tales modificaciones incluyeron la adición y elimi- nación de nucleótidos en el extremo 3’, teniendo en cuenta la posición del codón, así como la inclusión de sitios degenerados en posiciones altamente variables. Los oligonucleótidos se evaluaron a diferentes concentraciones sobre ARNs extraídos a partir de cultivos celula- res infectados y posteriormente de sueros de pacientes con diagnóstico probable de dengue. Resultados: Los oligonucleótidos amplificaron específicamente cada serotipo del virus dengue, tanto desde sobrenadantes de cultivo como desde muestras clínicas en prueba piloto. Conclusiones: El rediseño de los oligonucleótidos consideró la variabilidad genética acu- mulada en más de 15 años, mostrándose experimentalmente su valor y utilidad en la detección y tipificación del virus dengue. Palabras clave: RT-PCR...

Cloning, overexpression, purification, and physicochemical characterization of a cold shock protein homolog from the hyperthermophilic bacterium Thermotoga maritima.

Welker, C.; Böhm, G.; Schurig, H.; Jaenicke, R.
Fonte: Cold Spring Harbor Laboratory Press Publicador: Cold Spring Harbor Laboratory Press
Tipo: Artigo de Revista Científica
Publicado em /02/1999 EN
Relevância na Pesquisa
26.25%
Thermotoga maritima (Tm) expresses a 7 kDa monomeric protein whose 18 N-terminal amino acids show 81% identity to N-terminal sequences of cold shock proteins (Csps) from Bacillus caldolyticus and Bacillus stearothermophilus. There were only trace amounts of the protein in Thermotoga cells grown at 80 degrees C. Therefore, to perform physicochemical experiments, the gene was cloned in Escherichia coli. A DNA probe was produced by PCR from genomic Tm DNA with degenerated primers developed from the known N-terminus of TmCsp and the known C-terminus of CspB from Bacillus subtilis. Southern blot analysis of genomic Tm DNA allowed to produce a partial gene library, which was used as a template for PCRs with gene- and vector-specific primers to identify the complete DNA sequence. As reported for other csp genes, the 5' untranslated region of the mRNA was anomalously long; it contained the putative Shine-Dalgarno sequence. The coding part of the gene contained 198 bp, i.e., 66 amino acids. The sequence showed 61% identity to CspB from B. caldolyticus and high similarity to all other known Csps. Computer-based homology modeling allowed the conclusion that TmCsp represents a beta-barrel similar to CspB from B. subtilis and CspA from E. coli. As indicated by spectroscopic analysis...