Página 1 dos resultados de 417 itens digitais encontrados em 0.007 segundos

EVOLUTION OF ADENINE CLUSTERING IN 5S RIBOSOMAL-RNA

Guimaraes, R. C.; Erdmann, V. A.
Fonte: Tubingen Univ Press Attempto Verlag Publicador: Tubingen Univ Press Attempto Verlag
Tipo: Artigo de Revista Científica Formato: 13-45
ENG
Relevância na Pesquisa
76.38%
The frequency of adenine mononucleotides (A), dinucleotides (AA) and clusters, and the positions of clusters, were studied in 502 molecules of the 5S rRNA.All frequencies were reduced in the evolutive lines of vertebrates, plants and fungi, in parallel with increasing organismic complexity. No change was observed in invertebrates. All frequencies were increased in mitochondria, plastids and mycoplasmas. The presumed relatives to the ancestors of the organelles, Rhodobacteria alfa and Cyanobacteria, showed intermediate values, relative to the eubacterial averages. Firmibacterid showed very high number of cluster sites.Clusters were more frequent in single-stranded regions in all organisms. The routes of organelles and mycoplasmas accummulated clusters at faster rates in double-stranded regions. Rates of change were higher for AA and clusters than for A in plants, vertebrates and organeltes, higher for cluster sites and A in mycoplasmas, and higher for AA and A in fungi. These data indicated that selection pressures acted more strongly on adenine clustering than on adenine frequency.It is proposed that AA and clusters, as sites of lower informational content. have the property of tolerating positional variation in the sites of other molecules (or other regions of the same molecule) that interact with the adenines. This reasoning was consistent with the degrees of genic polymorphism. low in plants and vertebrates and high in invertebrates. In the eubacteria endosymbiontic or parasitic to eukaryotes...

Cytogenetic mapping of H1 histone and ribosomal RNA genes in hybrids between catfish species Pseudoplatystoma corruscans and Pseudoplatystoma reticulatum

Hashimoto, D. T.; Ferguson-Smith, M. A.; Rens, W.; Prado, F. D.; Foresti, F.; Porto-Foresti, F.
Fonte: Universidade Estadual Paulista Publicador: Universidade Estadual Paulista
Tipo: Artigo de Revista Científica Formato: 102-106
ENG
Relevância na Pesquisa
66.62%
A physical chromosome mapping of the H1 histone and 5S and 18S ribosomal RNA (rRNA) genes was performed in interspecific hybrids of Pseudoplatystoma corruscans and P. reticulatum. The results showed that 5S rRNA clusters were located in the terminal region of 2 chromosomes. H1 histone and 18S ribosomal genes were co-localized in the terminal portion of 2 chromosomes (distinct from the chromosomes bearing 5S clusters). These results represent the first report of association between H1 histone and 18S genes in fish genomes. The chromosome clustering of ribosomal and histone genes was already reported for different organisms and suggests a possible selective pressure for the maintenance of this association. © 2012 S. Karger AG, Basel.

Estudo da organização do gene ribossomal 5S em populações de Engystomops da Amazônia (Anura, Leiuperidae); The study of the organization of the 5S ribosomal gene in populations of Amazonian Engystomops (Anura, Leiuperidae)

Débora Silva Rodrigues
Fonte: Biblioteca Digital da Unicamp Publicador: Biblioteca Digital da Unicamp
Tipo: Dissertação de Mestrado Formato: application/pdf
Publicado em 16/02/2012 PT
Relevância na Pesquisa
66.48%
O gênero Engystomops apresenta ampla distribuição geográfica e constitui um interessante grupo de anuros para estudos cariotípicos. As populações de Engystomops encontradas na Amazônia têm sua identificação taxonômica ainda controversa. Análises genéticas e citogenéticas apoiam hipóteses que sugerem a existência de um complexo de espécies crípticas e especiação incipiente. Muitas vezes a variação citogenética observada entre diferentes populações estudadas dificultou o reconhecimento de homeologias cromossômicas entre os cariótipos. Uma caracterização cromossômica mais detalhada poderia auxiliar no possível reconhecimento de homeologias cromossômicas e, dessa forma, contribuir para o estudo dos processos envolvidos na divergência desses anuros. Já que o gene do DNAr 5S tem sido importante marcador genético e citogenético para estudos evolutivos e para a identificação e comparação de espécies em diversos grupos, no presente trabalho o DNAr 5S de Engystomops freibergi e de exemplares de Engystomops petersi de duas localidades Equatorianas (Puyo e Yasuní) foi estudado. Em todos os casos, dois tipos de DNAr 5S, facilmente diferenciados pelo tamanho e composição da sequência do seu espaçador não transcrito...

Mapping of the 18S and 5S ribosomal RNA genes in Astyanax altiparanae Garutti & Britski, 2000 (Teleostei, Characidae) from the upper Paraná river basin, Brazil

Fernandes,Carlos Alexandre; Martins-Santos,Isabel Cristina
Fonte: Sociedade Brasileira de Genética Publicador: Sociedade Brasileira de Genética
Tipo: Artigo de Revista Científica Formato: text/html
Publicado em 01/01/2006 EN
Relevância na Pesquisa
66.28%
Fluorescence in situ hybridization (FISH) was undertaken in order to determinate the chromosomal distribution pattern of 18S and 5S ribosomal DNAs (rDNA) in four populations of the characid fish Astyanax altiparanae from the upper Paraná river basin, Brazil. The 18S rDNA probe FISH revealed numerical and positional variations among specimens from the Keçaba stream compared to specimens of the other populations studied. In contrast to the variable 18S rDNA distribution pattern, highly stable chromosomal positioning of the 5S rDNA sites was observed in the four A. altiparanae populations. Divergence in the distribution pattern of 18S and 5S rDNA sites is also discussed.

Temporal order of replication of Xenopus laevis 5S ribosomal RNA genes in somatic cells.

Gilbert, D M
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em /05/1986 EN
Relevância na Pesquisa
66.28%
The timing of replication of both the somatic and oocyte-type 5S ribosomal RNA genes of Xenopus laevis was determined in cultured cells by using 5-bromodeoxyuridine labeling of DNA coupled with a retroactive synchrony technique employing the fluorescence-activated cell sorter (FACS). The somatic genes replicate very early in S phase, while the oocyte genes replicate very late. These experiments provide direct evidence for a model [Gottesfeld, J. & Bloomer, L. S. (1982) Cell 28, 781-791] in which the transcription-activating factor TFIIIA is required at the time of Xenopus 5S rRNA gene replication to facilitate transcription of these genes.

Nucleotide sequence of a 5S ribosomal RNA gene in the sea urchin Lytechinus variegatus.

Lu, A L; Steege, D A; Stafford, D W
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em 25/04/1980 EN
Relevância na Pesquisa
66.28%
The nucleotide sequence of a cloned DNA fragment corresponding to a gene for 5S ribosomal RNA from the sea urchin Lytechinus variegatus has been determined. This sequence is representative of the dominant species of 5S rRNA labelled in vivo with 32pO4 during the cleavage stage of Lytechninus embryonic development.

Melting of local ordered structures in yeast 5S ribosomal RNA in aqueous salts.

Ohta, S; Maruyama, S; Nitta, K; Sugai, S
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em 25/05/1983 EN
Relevância na Pesquisa
66.32%
Equilibrium and kinetics of thermal melting of yeast 5S ribosomal RNA in aqueous NaCl with or without Mg2+ were investigated by differential thermal melting and temperature jump methods. Two peaks (1 and 2) and a shoulder were observed in each of melting curves at ionic strength I=0.002-0.5 and linearity between each of melting temperatures T1m and T2m and log I was found at I=0.01-0.5 in the Mg2+-free solution. The local structures were found to be stabilized considerably by Mg2+. The temperature jump measurements gave the kinetic melting curve of the structure 1 at I=0.03 without Mg2+ or with 0.5 mM Mg2+. The kinetic Tm coincided well with the corresponding static Tm. For the structure 1, various parameters were calculated from the kinetic data, which indicated a double helical character of the structure 1. In terms of the values of Tm, G-C content, and enthalpy change of the transition of the structure 1 or 2, appropriateness of each of the secondary structure models of eukaryotic 5S RNA proposed previously was discussed.

Nucleotide sequences of the 5S ribosomal RNA genes and their adjacent regions in Schizosaccharomyces pombe.

Tabata, S
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em 11/12/1981 EN
Relevância na Pesquisa
66.44%
The organization of 5S ribosomal RNA (rRNA) genes in the genome of Schizosaccharomyces pombe has been investigated by restriction and hybridization analyses. The 5S rRNA genes were not linked to the other three species of rRNA genes which formed a repeating unit of 6.9 megadaltons, but located in other regions surrounded by heterogeneous sequences. The 5S rRNA gene organization in S. pombe is therefore different from those in other yeasts; Saccharomyces cerevisiae and Torulopsis utilis. Four restriction segments of different sizes each containing a single 5S rRNA gene were cloned on a bacterial plasmid, and the sequences in and around the RNA coding regions were determined. In the RNA coding regions, the sequences in four clones were identical with an exception that one residue has been substituted in one clone. In the flanking regions, the sequences were extremely rich in the AT-content and highly heterogeneous. The sequences were also markedly different from those in the corresponding regions of the other two yeasts. THe presence of T-clusters in the regions immediately after the RNA coding sequences was only notable homology among the four clones and the other two yeasts.

An elongated model of the Xenopus laevis transcription factor IIIA-5S ribosomal RNA complex derived from neutron scattering and hydrodynamic measurements.

Timmins, P A; Langowski, J; Brown, R S
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em 12/09/1988 EN
Relevância na Pesquisa
66.45%
The precise molecular composition of the Xenopus laevis TFIIIA-5S ribosomal RNA complex (7S particle) has been established from small angle neutron and dynamic light scattering. The molecular weight of the particle was found to be 95,700 +/- 10,000 and 86,700 +/- 9000 daltons from these two methods respectively. The observed match point of 54.4% D2O obtained from contrast variation experiments indicates a 1:1 molar ratio. It is concluded that only a single molecule of TFIIIA, a zinc-finger protein, and of 5S RNA are present in this complex. At high neutron scattering contrast radius of gyration of 42.3 +/- 2 A was found for the 7S particle. In addition a diffusion coefficient of 4.4 x 10(-11) [m2 s-1] and a sedimentation coefficient of 6.2S were determined. The hydrodynamic radius obtained for the 7S particle is 48 +/- 5 A. A simple elongated cylindrical model with dimensions of 140 A length and 59 A diameter is compatible with the neutron results. A globular model can be excluded by the shallow nature of the neutron scattering curves. It is proposed that the observed difference of 15 A in length between the 7S particle and isolated 5S RNA most likely indicates that part(s) of the protein protrudes from the end(s) of the RNA molecule. There is no biochemical evidence for any gross alteration in 5S RNA conformation upon binding to TFIIIA.

Cytoplasmic retention and nuclear import of 5S ribosomal RNA containing RNPs.

Rudt, F; Pieler, T
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em 15/03/1996 EN
Relevância na Pesquisa
66.55%
Nuclear export of newly transcribed 5S ribosomal RNA in Xenopus oocytes occurs in the context of either a complex with the ribosomal protein L5 (5S RNP) or with the transcription factor IIIA (7S RNP). Here we examine nuclear import of 5S RNA, L5 and TFIIIA. The 5S RNP shuttles between nucleus and cytoplasm and only 5S RNA variants which can bind to L5 gain access to the nucleus. The 7S RNP is retained in the cytoplasm. Only TFIIIA which is not bound to 5S RNA is imported into the nucleus. As a novel mechanism for cytoplasmic retention, we propose that RNA binding masks a nuclear localization sequence in TFIIIA. In contrast to the nuclear import of L5, import of TFIIIA is sensitive towards the nuclear localization sequence (NLS) competitor p(lys)-BSA, suggesting that these two proteins make use of different import pathways.

Identification of the gene encoding the 5S ribosomal RNA maturase in Bacillus subtilis: mature 5S rRNA is dispensable for ribosome function.

Condon, C; Brechemier-Baey, D; Beltchev, B; Grunberg-Manago, M; Putzer, H
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em /02/2001 EN
Relevância na Pesquisa
66.46%
Over 25 years ago, Pace and coworkers described an activity called RNase M5 in Bacillus subtilis cell extracts responsible for 5S ribosomal RNA maturation (Sogin & Pace, Nature, 1974, 252:598-600). Here we show that RNase M5 is encoded by a gene of previously unknown function that is highly conserved among the low G + C gram-positive bacteria. We propose that the gene be named rnmV. The rnmV gene is nonessential. B. subtilis strains lacking RNase M5 do not make mature 5S rRNA, indicating that this process is not necessary for ribosome function. 5S rRNA precursors can, however, be found in both free and translating ribosomes. In contrast to RNase E, which cleaves the Escherichia coli 5S precursor in a single-stranded region, which is then trimmed to yield mature 5S RNA, RNase M5 cleaves the B. subtilis equivalent in a double-stranded region to yield mature 5S rRNA in one step. For the most part, eubacteria contain one or the other system for 5S rRNA production, with an imperfect division along gram-negative and gram-positive lines. A potential correlation between the presence of RNase E or RNase M5 and the single- or double-stranded nature of the predicted cleavage sites is explored.

A Plant 5S Ribosomal RNA Mimic Regulates Alternative Splicing of Transcription Factor IIIA Pre-mRNAs

Hammond, Ming C.; Wachter, Andreas; Breaker, Ronald R.
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
EN
Relevância na Pesquisa
66.58%
Transcription factor IIIA (TFIIIA) is required for eukaryotic synthesis of 5S ribosomal RNA by RNA polymerase III. Here we report the discovery of a structured RNA element with striking resemblance to 5S rRNA that is conserved within TFIIIA precursor mRNAs (pre-mRNAs) from diverse plant lineages. TFIIIA protein expression is controlled by alternative splicing of the exon containing the plant 5S rRNA mimic (P5SM). P5SM triggers exon skipping upon binding of ribosomal protein L5, a natural partner of 5S rRNA, which demonstrates the functional adaptation of its structural mimicry. Since the exon-skipped splice product encodes full-length TFIIIA protein, these results reveal a ribosomal protein-mRNA interaction that is involved in 5S rRNA synthesis and has implications for cross-coordination of ribosomal components. This study also provides insight into the origin and function of a newfound class of structured RNA that regulates alternative splicing.

5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

Donati, Giulio; Peddigari, Suresh; Mercer, Carol A.; Thomas, George
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
EN
Relevância na Pesquisa
66.48%
Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event...

The nucleotide sequence of 4.5S ribosomal RNA from tobacco chloroplasts.

Takaiwa, F; Sugiura, M
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em 25/09/1980 EN
Relevância na Pesquisa
66.32%
The nucleotide sequence of tobacco chloroplast 4.5S ribosomal RNA has been determined to be: OHG-A-A-G-G-U-C-A-C-G-G-C-G-A-G-A-C-G-A-G-C-C-G-U-U-U-A-U-C-A-U-U-A-C-G-A-U-A-G-G-U-G-U-C-A-A-G-U-G-G-A-A-G-U-G-C-A-G-U-G-A-U-G-U-A-U-G-C-(G-A)-C-U-G-A-G-G-C-A-U-C-C-U-A-A-C-A-G-A-C-C-G-G-U-A-G-A-C-U-U-G-A-A-COH. The 4.5S RNA is 103 nucleotides long and its 5'-terminus is not phosphorylated.

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Delihas, N; Andersen, J; Sprouse, H M; Dudock, B
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em 25/06/1981 EN
Relevância na Pesquisa
66.69%
Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.

Unusual structural features of the 5S ribosomal RNA from Streptococcus cremoris.

Neimark, H; Andersen, J; Delihas, N
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em 11/11/1983 EN
Relevância na Pesquisa
66.52%
The nucleotide sequence of the 5S ribosomal RNA of Streptococcus cremoris has been determined. The sequence is 5' (sequence in text) 3'. Comparison of the S. cremoris 5S RNA sequence to an updated prokaryotic generalized 5S RNA structural model shows that this 5S RNA contains some unusual structural features. These features result largely from uncommon base substitutions in helices I, II and IV. Some of these unusual structural features are shared by several of the known 5S RNA sequences from mycoplasmas. However, the characteristic bloc of deletions found in helix V of these mycoplasma 5S RNAs is not present in the 5S RNA of S. cremoris.

5S ribosomal RNA genes of the newt Notophthalmus viridescens.

Kay, B K; Gall, J G
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em 11/12/1981 EN
Relevância na Pesquisa
66.32%
The genes which code for the 5S ribosomal RNA in the newt, Notophthalmus viridescens have been cloned and analyzed. Two types of repeating unit were detected: a major type consisting of a 120 bp coding region with a 111 bp spacer, and a minor type composed of a coding region, a pseudogene, and a 113 bp spacer. The pseudogene is a 36 bp segment which corresponds to the 3' terminal third of the 5S RNA gene, and is situated immediately 3' to the gene, being separated from it by 2 bp. Two recombinant plasmids were obtained in which the major and minor units were arranged in an interspersed pattern.

Highly conserved 5S ribosomal RNA sequences in four rust fungi and atypical 5S rRNA secondary structure in Microstroma juglandis.

Gottschalk, M; Blanz, P A
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em 11/05/1984 EN
Relevância na Pesquisa
66.38%
The 5S ribosomal RNA nucleotide sequences of five basidiomycetous fungi, Coleosporium tussilaginis , Gymnosporangium clavariaeforme , Puccinia poarum , Endophyllum sempervivi and Microstroma juglandis were determined. Despite high differentiation in their host spectra the four rust species are highly conserved with respect to their 5S rRna sequences, which fit with the basidiomycete cluster 5 described by Walker and Doolittle (1). The sequences obtained from the first three rust fungi were proven to be identical while the sequence from Endophyllum sempervivi showed two base substitutions compared with the other rust fungi. The Microstroma juglandis 5S rRNA sequence differs from all other basidiomycete 5S rRNA sequences published so far in respect to its secondary structure which shows an atypical 'CCA' loop in helix D, but it reveals typical basidiomycetous signature nucleotides. Therefore Microstroma juglandis represents a cluster of its own within the Basidiomycetes. A dendrogram was constructed based on Kimura's "Neutral Theory of Molecular Evolution".

Oocyte and somatic 5S ribosomal RNA and 5S RNA encoding genes in Xenopus tropicalis.

Nietfeld, W; Digweed, M; Mentzel, H; Meyerhof, W; Köster, M; Knöchel, W; Erdmann, V A; Pieler, T
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em 26/09/1988 EN
Relevância na Pesquisa
66.54%
We have investigated the structure of oocyte and somatic 5S ribosomal RNA and of 5S RNA encoding genes in Xenopus tropicalis. The sequences of the two 5S RNA families differ in four positions, but only one of these substitutions, a C to U transition in position 79 within the internal control region of the corresponding 5S RNA encoding genes, is a distinguishing characteristic of all Xenopus somatic and oocyte 5S RNAs characterized to date, including those from Xenopus laevis and Xenopus borealis. 5S RNA genes in Xenopus tropicalis are organized in clusters of multiple repeats of a 264 base pair unit; the structural and functional organization of the Xenopus tropicalis oocyte 5S gene is similar to the somatic but distinct from the oocyte 5S DNA in Xenopus laevis and Xenopus borealis. A comparative sequence analysis reveals the presence of a strictly conserved pentamer motif AAAGT in the 5'-flanking region of Xenopus 5S genes which we demonstrate in a separate communication to serve as a binding signal for an upstream stimulatory factor.

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

Delihas, N; Andersen, J; Andresini, W; Kaufman, L; Lyman, H
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em 11/12/1981 EN
Relevância na Pesquisa
66.6%
The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.