Página 16 dos resultados de 2965 itens digitais encontrados em 0.010 segundos

The nucleotide sequences of 5S rRNAs from two red algae, Gracilaria compressa and Porphyra tenera.

Lim, B L; Hori, H; Osawa, S
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em 11/08/1983 EN
Relevância na Pesquisa
27%
The nucleotide sequences of 5S rRNA from two red algae, Gracilaria compressa and Porphyra tenera have been determined. The two 5S rRNAs are fairly dissimilar to each other in their sequences (65% identity), although they are both composed of 121 nucleotides. Their secondary structures are generally of the eukaryotic with a prokaryotic characteristic. Judged from the 5S rRNA sequence data, the red algae are phylogenically distinct from green and brown algae, and they, Porphyra in particular, are evolutionally most ancient among the eukaryotes of which 5S rRNA sequence has been determined.

The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum.

Luehrsen, K R; Fox, G E; Kilpatrick, M W; Walker, R T; Domdey, H; Krupp, G; Gross, H J
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em 25/02/1981 EN
Relevância na Pesquisa
27%
The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH. The homology with the 55 rRNA from another archaebacterial species, Halobacterium cutirubrum, is only 60.6% and other 55 rRNAs are even less homologous. Examination of the potential for forming secondary structure is revealing. T. acidophilum does not conform to the usual models employed for either procaryotic or eucaryotic 5S rRNAs. Instead this 5S rRNA has a mixture of the characteristic features of each. On the whole this 5S rRNA does however appear more eucaryotic than eubacterial. These results give further support to the notion that the archaebacteria represent an extremely early divergence among entities with procaryotic organization.

Nucleotide sequences of Acanthamoeba castellanii 5S and 5.8S ribosomal ribonucleic acids: phylogenetic and comparative structural analyses.

MacKay, R M; Doolittle, W F
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em 24/07/1981 EN
Relevância na Pesquisa
27%
Sequences of 5S and 5.8S rRNAs of the amoeboid protist Acanthamoeba castellanii have been determined by gel sequencing of terminally-labeled RNAs which were partially degraded with chemical reagents or ribonucleases. The sequence of the 5S rRNA is (formula, see text). This sequence is compared to eukaryotic 5S rRNA sequences previously published and fitted to a secondary structure model which incorporates features of several previously proposed models. All reported eukaryotic 5S rRNAs fit this model. The sequence of the 5.8S rRNA is (formula, see text). This sequence does not fit parts of existing secondary structure models for 5.8S rRNA, and we question the significance of such models.

Nucleotide sequences of the 5S ribosomal RNA genes and their adjacent regions in Schizosaccharomyces pombe.

Tabata, S
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em 11/12/1981 EN
Relevância na Pesquisa
27%
The organization of 5S ribosomal RNA (rRNA) genes in the genome of Schizosaccharomyces pombe has been investigated by restriction and hybridization analyses. The 5S rRNA genes were not linked to the other three species of rRNA genes which formed a repeating unit of 6.9 megadaltons, but located in other regions surrounded by heterogeneous sequences. The 5S rRNA gene organization in S. pombe is therefore different from those in other yeasts; Saccharomyces cerevisiae and Torulopsis utilis. Four restriction segments of different sizes each containing a single 5S rRNA gene were cloned on a bacterial plasmid, and the sequences in and around the RNA coding regions were determined. In the RNA coding regions, the sequences in four clones were identical with an exception that one residue has been substituted in one clone. In the flanking regions, the sequences were extremely rich in the AT-content and highly heterogeneous. The sequences were also markedly different from those in the corresponding regions of the other two yeasts. THe presence of T-clusters in the regions immediately after the RNA coding sequences was only notable homology among the four clones and the other two yeasts.

A ribonuclease-resistant region of 5S RNA and its relation to the RNA binding sites of proteins L18 and L25.

Douthwaite, S; Garrett, R A; Wagner, R; Feunteun, J
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em 11/06/1979 EN
Relevância na Pesquisa
27%
An RNA fragment, constituting three subfragments of nucleotide sequences 1-11, 69-87 and 89-120, is the most ribonuclease-resistant part of the native 5S RNA of Escherichia coli, at 0 degrees C. A smaller fragment of nucleotide sequence 69-87 and 90-110 is ribonuclease-resistant at 25 degrees. Degradation of the L25-5S RNA complex with ribonuclease A or T2 yielded RNA fragments similar to those of the free 5S RNA at 0 degrees C and 25 degrees C; moreover L25 remained strongly bound to both RNA fragments and also produced some opening of the RNA structure in at least two positions. Protein L18 initially protected most of the 5S RNA against ribonuclease digestion, at 0 degrees C, but was then gradually released prior to the formation of the larger RNA fragment. It cannot be concluded, therefore, as it was earlier (Gray et al., 1973), that this RNA fragment contains the primary binding site of L18.

Homologous genes for mouse 4.5S hybRNA are found in all eukaryotes and their low molecular weight RNA transcripts intermolecularly hybridize with eukaryotic 18S ribosomal RNAs.

Trinh-Rohlik, Q; Maxwell, E S
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em 11/07/1988 EN
Relevância na Pesquisa
27%
Previous work has reported the isolation and sequencing of a mouse low molecular weight RNA species designated 4.5S hybridizing RNA or hybRNA because of its ability to intermolecularly hybridize with mouse mRNA and 18S rRNA sequences. Using synthetic DNA oligonucleotide probes we have examined the conservation of this gene sequence and its expression as a lmwRNA transcript across evolution. Southern blot analysis has shown that homologous genes of single or low copy number are found in all eukaryotes examined as well as in E. coli. Northern blot analysis has demonstrated 4.5S hybRNA transcription in all mouse tissues as well as expression in yeast and Xenopus laevis as lmwRNAs of approximately 130 and 100 nucleotides, respectively, as compared with mouse/rat/hamster species of approximately 87 nucleotides. Yeast and X. laevis 4.5S hybRNA homologs, isolated by hybrid-selection, were shown by Northern blot analysis to intermolecularly hybridize with homologous as well as heterologous 18S rRNA sequences. The conservation of 4.5S hybRNA homologous genes and their expression as lmwRNA transcripts with common intermolecular RNA:RNA hybridization capabilities in fungi, amphibians, and mammals argues for a common, conserved and required biological function for this lmwRNA in all eukaryotes and potential utilization of its intermolecular RNA:RNA hybridization capabilities to carry out this function.

An elongated model of the Xenopus laevis transcription factor IIIA-5S ribosomal RNA complex derived from neutron scattering and hydrodynamic measurements.

Timmins, P A; Langowski, J; Brown, R S
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em 12/09/1988 EN
Relevância na Pesquisa
27%
The precise molecular composition of the Xenopus laevis TFIIIA-5S ribosomal RNA complex (7S particle) has been established from small angle neutron and dynamic light scattering. The molecular weight of the particle was found to be 95,700 +/- 10,000 and 86,700 +/- 9000 daltons from these two methods respectively. The observed match point of 54.4% D2O obtained from contrast variation experiments indicates a 1:1 molar ratio. It is concluded that only a single molecule of TFIIIA, a zinc-finger protein, and of 5S RNA are present in this complex. At high neutron scattering contrast radius of gyration of 42.3 +/- 2 A was found for the 7S particle. In addition a diffusion coefficient of 4.4 x 10(-11) [m2 s-1] and a sedimentation coefficient of 6.2S were determined. The hydrodynamic radius obtained for the 7S particle is 48 +/- 5 A. A simple elongated cylindrical model with dimensions of 140 A length and 59 A diameter is compatible with the neutron results. A globular model can be excluded by the shallow nature of the neutron scattering curves. It is proposed that the observed difference of 15 A in length between the 7S particle and isolated 5S RNA most likely indicates that part(s) of the protein protrudes from the end(s) of the RNA molecule. There is no biochemical evidence for any gross alteration in 5S RNA conformation upon binding to TFIIIA.

Characterization of the repressed 5S DNA minichromosomes assembled in vitro with a high-speed supernatant of Xenopus laevis oocytes.

Shimamura, A; Tremethick, D; Worcel, A
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em /10/1988 EN
Relevância na Pesquisa
27%
We describe an in vitro system, based on the Xenopus laevis oocyte supernatant of Glikin et al. (G. Glikin, I. Ruberti, and A. Worcel, Cell 37:33-41, 1984), that packages DNA into minichromosomes with regularly spaced nucleosomes containing histones H3, H4, H2A, and H2B but no histone H1. The same supernatant also assembles the 5S RNA transcription complex; however, under the conditions that favor chromatin assembly, transcription is inhibited and a phased nucleosome forms over the 5S RNA gene. The minichromosomes that are fully loaded with nucleosomes remain refractory to transcriptional activation by 5S RNA transcription factors. Our data suggest that this repression is caused by a nucleosome covering the 5S RNA gene and that histone H1 is not required for regular nucleosome spacing or for gene repression in this system.

A Model for Protein Synthesis Involving the Intermediate Formation of Peptidyl-5S RNA

Raacke, Ilse Dorothea
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em /10/1971 EN
Relevância na Pesquisa
27%
A model for protein synthesis is proposed in which the donor for the peptide elongation reaction is peptidyl-5S RNA. Space-filling models show that peptide bond formation between peptidyl-5S RNA and aminoacyl-tRNA is eminently feasible from a stereochemical point of view. The peptide is transferred to 5S RNA, while at the same time the deacylated tRNA is exchanged by a new aminoacyl-tRNA acceptor. Two peptidyl transferases are required by the model, both of which have sites for binding the termini of both aminoacyl-tRNA and peptidyl-5S RNA. The model makes detailed predictions about the properties of the transferases.

Structural analysis of a triple complex between the histone octamer, a Xenopus gene for 5S RNA and transcription factor IIIA.

Rhodes, D
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em 16/12/1985 EN
Relevância na Pesquisa
27%
This paper reports three experiments concerning the structural relationship between the Xenopus transcription factor IIIA (TFIIIA), the histone octamer and the Xenopus somatic gene for 5S RNA. Quantitative footprinting methods have been used in order to discover where and how TFIIIA and the histone octamer bind to the same gene independently and also in a triple complex. First, DNaseI and DNaseII protection experiments show that TFIIIA binds to positions 45-97 within the gene, in agreement with other workers. Second, the histone octamer takes up a unique, well-defined position with respect to DNA sequence. The nucleosome core extends to position 78 of the gene and therefore overlaps the TFIIIA binding region by approximately 35 bp. Third, it is shown that a triple complex can be formed between TFIIIA, the histone octamer and the 5S RNA gene. TFIIIA displaces the DNA from the histone surface in the 35-bp region of overlap. This has led to a three-dimensional model which explains how RNA polymerase III could interact simultaneously with transcription factors bound at the internal control region of the 5S RNA gene and the start point of transcription. The model also explains how histone H1 could repress transcription of 5S RNA genes.

Cytoplasmic regulation of 5S RNA genes in nuclear-transplant embryos.

Wakefield, L; Gurdon, J B
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em //1983 EN
Relevância na Pesquisa
27%
In the normal development of Xenopus laevis, genes for oocyte-type and somatic-type 5S RNAs are both expressed in late blastulae. Estimates of rates of synthesis indicate that the oocyte-type genes (5Sooc) undergo at least a 100-fold reduction in transcriptional activity between the end of oogenesis and the late blastula stage, and at least a further 20-fold reduction during gastrulation. When neurula nuclei, with inactive 5Sooc genes, were transplanted to enucleated eggs, the resulting nuclear-transplant embryos showed a reactivation of 5Sooc genes in blastulae and a subsequent inactivation after this stage. This effect is not explicable by a differential stability of the two types of 5S RNA. We conclude that egg or early embryo cytoplasm must contain components which can continuously regulate 5S gene expression, and that the mechanism by which 5Sooc genes are developmentally inactivated does not persist through mitosis in early embryos. These results have been obtained by a new procedure in which oocyte- and somatic-type 5S RNAs are separated in a 4 M urea-15% acrylamide gel.

Use of chromosomal translocations with in situ DNA hybridisation to confirm localisation of human 5S ribosomal RNA genes.

Fennell, S J; Malcolm, S; Williamson, R; Ferguson-Smith, M A
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em /08/1979 EN
Relevância na Pesquisa
27%
Two cases of chromosomal translocations involving the long arm of chromosome 1 were investigated for 5S ribosomal gene localisation using in situ hybridisation. In the first family, there was an interstitial translocation of 1q25-32 to chromosome 5; the 5S genes remained on chromosome 1. In the second family, there was a translocation of 1q42-44 to chromosome 21q12; the 5S gene locus in this case was translocated. This shows that the 5S ribosomal genes are at position 1q42-44, confirming a previous assignment based on adenovirus-induced uncoiling and on a partial trisomy (Steffensen et al., 1977).

Sites of the 5s Ribosomal Genes in Drosophila. I. the Multiple Clusters in the VIRILIS Group

Wimber, D. E.; Wimber, Doris R.
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em /05/1977 EN
Relevância na Pesquisa
27%
Drosophila melanogaster 125I-5S RNA was annealed to salivary gland preparations of 6 species in the virilis group of Drosophila. Two patterns of annealing were found. D. virilis, D. montana and D. borealis showed three 5S gene clusters on chromosome 5; Sd–f and Wc–j were strongly labeled, but Xa–e was weakly labeled. D. montana and D. borealis have a greater percentage of their total 5S cistrons at S d–f than does D. virilis. D. americana americana, D. americana texana and D. novamexicana showed 2 sites labeled; no label was seen at Sd–f while Wc–j was weakly labeled and Xa–e was strongly labeled, the reciprocal of the previous pattern in the W-X region. Hybrids between D. a. americana and D. virilis showed no difference in chromosome banding at the sites of the 5S clusters despite their pattern differences. D. a texana x D. virilis, on the other hand, did show a difference in staining the Xa–e region. These patterns fall squarely into the biosystematic groupings deduced by many previous workers.

Structure of 5S rRNA within the Escherichia coli ribosome: iodine-induced cleavage patterns of phosphorothioate derivatives.

Shpanchenko, O V; Dontsova, O A; Bogdanov, A A; Nierhaus, K H
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em /09/1998 EN
Relevância na Pesquisa
27%
The protection patterns of 5S rRNA in solution, within the ribosomal 50S subunit, 70S ribosomes, and functional complexes, were assessed with the phosphorothioate method. About 20% of the analyzed positions (G9-G107) showed strong assembly defects: A phosphorothioate at one of these positions significantly impaired the incorporation of 5S rRNA into 50S particles. The reverse has also been observed: A phosphorothioate is preferred over a phosphate residue in the assembly process at a few positions. The results further demonstrate that 5S rRNA undergoes conformational changes during the assembly in the central protuberance of the 50S subunit and upon association with the small ribosomal subunit forming a 70S ribosome. In striking contrast, when the 70S ribosomes are once formed, the contact pattern of the 5S rRNA is the same in various functional states such as initiation-like complexes and pre- and posttranslocational states.

Important role of the tetraloop region of 4.5S RNA in SRP binding to its receptor FtsY.

Jagath, J R; Matassova, N B; de Leeuw, E; Warnecke, J M; Lentzen, G; Rodnina, M V; Luirink, J; Wintermeyer, W
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em /02/2001 EN
Relevância na Pesquisa
27%
Binding of Escherichia coli signal recognition particle (SRP) to its receptor, FtsY, requires the presence of 4.5S RNA, although FtsY alone does not interact with 4.5S RNA. In this study, we report that the exchange of the GGAA tetraloop sequence in domain IV of 4.5S RNA for UUCG abolishes SRP-FtsY interaction, as determined by gel retardation and membrane targeting experiments, whereas replacements with other GNRA-type tetraloops have no effect. A number of other base exchanges in the tetraloop sequence have minor or intermediate inhibitory effects. Base pair disruptions in the stem adjacent to the tetraloop or replacement of the closing C-G base pair with G-C partially restored function of the otherwise inactive UUCG mutant. Chemical probing by hydroxyl radical cleavage of 4.5S RNA variants show that replacing GGAA with UUCG in the tetraloop sequence leads to structural changes both within the tetraloop and in the adjacent stem; the latter change is reversed upon reverting the C-G closing base pair to G-C. These results show that the SRP-FtsY interaction is strongly influenced by the structure of the tetraloop region of SRP RNA, in particular the tetraloop stem, and suggest that both SRP RNA and Ffh undergo mutual structural adaptation to form SRP that is functional in the interaction with the receptor...

A methylated Neurospora 5S rRNA pseudogene contains a transposable element inactivated by repeat-induced point mutation.

Margolin, B S; Garrett-Engele, P W; Stevens, J N; Fritz, D Y; Garrett-Engele, C; Metzenberg, R L; Selker, E U
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em /08/1998 EN
Relevância na Pesquisa
27%
In an analysis of 22 of the roughly 100 dispersed 5S rRNA genes in Neurospora crassa, a methylated 5S rRNA pseudogene, Psi63, was identified. We characterized the Psi63 region to better understand the control and function of DNA methylation. The 120-bp 5S rRNA-like region of Psi63 is interrupted by a 1.9-kb insertion that has characteristics of sequences that have been modified by repeat-induced point mutation (RIP). We found sequences related to this insertion in wild-type strains of N. crassa and other Neurospora species. Most showed evidence of RIP; but one, isolated from the N. crassa host of Psi63, showed no evidence of RIP. A deletion from near the center of this sequence apparently rendered it incapable of participating in RIP with the related full-length copies. The Psi63 insertion and the related sequences have features of transposons and are related to the Fot1 class of fungal transposable elements. Apparently Psi63 was generated by insertion of a previously unrecognized Neurospora transposable element into a 5S rRNA gene, followed by RIP. We name the resulting inactivated Neurospora transposon PuntRIP1 and the related sequence showing no evidence of RIP, but harboring a deletion that presumably rendered it defective for transposition...

Human Y5 RNA specializes a Ro ribonucleoprotein for 5S ribosomal RNA quality control

Hogg, J. Robert; Collins, Kathleen
Fonte: Cold Spring Harbor Laboratory Press Publicador: Cold Spring Harbor Laboratory Press
Tipo: Artigo de Revista Científica
Publicado em 01/12/2007 EN
Relevância na Pesquisa
27%
Humans express four distinct non-protein-coding Y RNAs (ncRNAs). To investigate Y RNA functional diversification, we exploited an RNA-based affinity purification method to isolate ribonucleoproteins (RNPs) assembled on individual human Y RNAs. Silver staining and mass spectrometry revealed that the Ro and La proteins assemble with all Y RNAs, while additional proteins associate with specific Y RNAs. Unexpectedly, Y5 RNA uniquely copurified ribosomal protein L5 and its binding partner 5S RNA. These findings reveal a contribution of Y5 to 5S surveillance and suggest that interactions between Ro-Y5 and L5–5S RNPs establish 5S RNA as a target of quality control.

MULTIPLE GENE SITES FOR 5S AND 18 + 28S RNA ON CHROMOSOMES OF GLYPTOTENDIPES BARBIPES (STAEGER)

Wen, Wu-Nan; León, Pedro E.; Hague, Donald R.
Fonte: The Rockefeller University Press Publicador: The Rockefeller University Press
Tipo: Artigo de Revista Científica
Publicado em 01/07/1974 EN
Relevância na Pesquisa
27%
Ribosomal RNAs (28 + 18S and 5S) and 4S RNA extracted from the chironomid Glyptotendipes barbipes were iodinated in vitro with 125I and hybridized to the salivary gland chromosomes of G. barbipes and Drosophila melanogaster. Iodinated 18 + 28 S RNA labeled three puffed sites with associated nucleoli on chromosomes IR, IIL, and IIIL of G. barbipes and the nucleolar organizer of Drosophila. Labeled 5S RNA hybridized to three sites on chromosome IIIR, two sites on chromosome IIR and one site in a Balbiani ring on chromosome IV of Glyptotendipes. Most of the label produced by this RNA was localized seven bands away from the centromere on the right arm of chromosome III, and we consider this to be the main site complementary to 5S RNA in the chironomid. This same RNA preparation specifically labeled the 56 EF region of chromosome IIR of Drosophila which has been shown previously to be the only site labeled when hybridized with homologous 5S RNA. Hybridization of G. barbipes chromosomes with iodinated 4S RNA produced no clearly localized labeled sites over the exposure periods studied.

Different Mechanisms for Pseudouridine Formation in Yeast 5S and 5.8S rRNAs▿

Decatur, Wayne A.; Schnare, Murray N.
Fonte: American Society for Microbiology (ASM) Publicador: American Society for Microbiology (ASM)
Tipo: Artigo de Revista Científica
EN
Relevância na Pesquisa
27%
The selection of sites for pseudouridylation in eukaryotic cytoplasmic rRNA occurs by the base pairing of the rRNA with specific guide sequences within the RNA components of box H/ACA small nucleolar ribonucleoproteins (snoRNPs). Forty-four of the 46 pseudouridines (Ψs) in the cytoplasmic rRNA of Saccharomyces cerevisiae have been assigned to guide snoRNAs. Here, we examine the mechanism of Ψ formation in 5S and 5.8S rRNA in which the unassigned Ψs occur. We show that while the formation of the Ψ in 5.8S rRNA is associated with snoRNP activity, the pseudouridylation of 5S rRNA is not. The position of the Ψ in 5.8S rRNA is guided by snoRNA snR43 by using conserved sequence elements that also function to guide pseudouridylation elsewhere in the large-subunit rRNA; an internal stem-loop that is not part of typical yeast snoRNAs also is conserved in snR43. The multisubstrate synthase Pus7 catalyzes the formation of the Ψ in 5S rRNA at a site that conforms to the 7-nucleotide consensus sequence present in other substrates of Pus7. The different mechanisms involved in 5S and 5.8S rRNA pseudouridylation, as well as the multiple specificities of the individual trans factors concerned, suggest possible roles in linking ribosome production to other processes...

Chromosomal location of 18S and 5S rDNA sites in Triportheus fish species (Characiformes, Characidae)

Diniz, Débora; Laudicina, Alejandro; Bertollo, Luiz Antonio Carlos
Fonte: Sociedade Brasileira de Genética Publicador: Sociedade Brasileira de Genética
Tipo: Artigo de Revista Científica
EN
Relevância na Pesquisa
27%
The location of 18S and 5S rDNA sites was determined in eight species and populations of the fish genus Triportheus by using fluorescent in situ hybridization (FISH). The males and females of all species had 2n = 52 chromosomes and a ZZ/ZW sex chromosome system. A single 18S rDNA site that was roughly equivalent to an Ag-NOR was detected on the short arms of a submetacentric pair in nearly all species, and up to two additional sites were also observed in some species. In addition, another 18S rDNA cluster was identified in a distal region on the long arms of the W chromosome; this finding corroborated previous evidence that this cluster would be a shared feature amongst Triportheus species. In T. angulatus, a heterozygotic paracentric inversion involving the short arms of one homolog of a metacentric pair was associated with NORs. The 5S rDNA sites were located on the short arms of a single submetacentric chromosomal pair, close to the centromeres, except in T. auritus, which had up to ten 5S rDNA sites. The 18S and 5S rDNA sites were co-localized and adjacent on the short arms of a chromosomal pair in two populations of T. nematurus. Although all Triportheus species have a similar karyotypic macrostructure, the results of this work show that in some species ribosomal genes may serve as species-specific markers when used in conjunction with other putatively synapomorphic features.